Description :
From Genome Similarity Track
Location :
Scaffold_70:28151- 37294
Transcript NameFunction/comments
Phyta_totarag2843hypothetical protein PHYSODRAFT_326574
Phyta_totarag2844U3 small nucleolar RNA-associated protein, putative
Phyta_totarag2845hypothetical protein

Sequence
9143 bases(100 bases per row)
CAAACCAGACACGAGTTCGCAGTCATGGGAGTCACTAGTGTTGACCCAAAGCCTGAACCGCCCACCACCGAAAGCCAAGTCTTTTACGAGTCCGTCGCGA
GCAAACTCGAAACAGCTTTTGGGCGTTCGCAGCCGCAACTAGAAGTCCGCTTCTCAGACCTGTCGGTATCCTGCAAGGTGGCTACGTTGAAGGCGAaaca
gcaagacgacgacgcaccaCCGGAACTGCCCACAATTTGGAACACGCTAAAGCATGCGGCCCAAAATCTTGTGTCGATAAGGAAGACGGAACAACGTGAT
ATTCTCAAGGGAATCAGCGGTGTGTTGCGTCCCGGAACGTTGACGTTGGTTCTAGGACAGCCAGGATCCGGgaagtcgacgctgctcaAGGCACTGAGTG
GACGACTGCGTGCGGACGGCAACCGTCTGAGTGTGATGGGCGAGATAACGTACAACGGCGAGCTTCAACATCTCCTTGCACAGCAATTGCCCCAACTCGC
TGCGTACGTGCCCCAAAATGACGAGCATTTCCCGCTTCTATCGGTGCAGGAAATGTTGTCTTTTGCGCACGCCTTCAGTGCCAGTGGTGACAGCGACATG
AGTCAACATGCCGCCATGTTGCTCGGACAAGATGCTGGCCACGATAGCCGACAGGCACTCAAGTCTGCCATGGACATGTTCCAGAACTACCCAGAGGTCA
TCAAGGGGCAGCTTGGGCTGCAGAACTGCTGGAATACTCTTGTCGGAGACAACATGGTGCGTGGCGTGTCGGGTGGAGAGAAGAAGCGAGTGACAACGGG
TGAGACGGTGCTCGGTATGCAGCGTGCTGTGTTCATGGACGAAATCAGTACGGGACTCGACAGCGCTGCAACCTTCGACATTGTCAGTACGCAGCGGGCC
ATCGCGCGGACGCTGGGCAAAACCATAGTCgtctcgttgctgcagcctccCCCAGACGTGTTTGCACTCTTTGACGACGTCATTCTCCTGAACGAGGGAG
AAGTGATGTATTATGGGCCTCGTGAAAAAGTTGTGGAGTACTTTGGTGACTTGGGTCTCCAGTGCCCTCCGAACCGAGCGTCGCCGATTTCTTGCTTGAT
CTCGGAACACCGCAGCAGTACGCGTATGAGTCCGCAATCGTCAGCGGTGGGATGAAGCCTCCTCGCCTAGCGAGTGAGTACGCGGAAATCTTTCGCTCTT
CTGACATTCATCTGGGTGCTCTTAACCTTTTGGAGACAAACGTCGACCACAACAACCTGAACAAGTGGAGCAAGTACCACAAGGCGATGCCGCAATTCCA
GCGATCTGTGTGGGCAAACGTGCCCACGCTCGTGCTacggcagcttctgctcATCATGCGTGATGTGAATACGCTGCGAAGTCGCATTGTCCTCGTCTTG
GTGGTAGCGCTAATTTGTTCCACTGCCTTTATAGATGTGGATGCAACAAACGTGGCGTTGGTGCTTGGAGTGCTCTTCATGTCTTCGATGTTCCCTCTCT
TCGAGCAGACGTCGCAGCTTTCAATGTTCGTCGACATGCGCGATATATTTTACAAGCAGCGCTCAGCCAACTTCTTCCAGACGTCGGCGTACGTACTCGC
GAATGTCATCAGCCAATTGCCGATCGCACTGCCCGAGAGTTTCATTTATGGGGCTTTTCTGTACTGGATCGCTGGGCTGGAGGCGGATGTCGGGAGCTTC
ATCTTGTACGAGCTGATCATCCTCCTCACCGTGATGGTGGCcgtcctcatcttcttcttcgttgctgcGATTTCCCTGAACATCTACATTACGAATCCTC
TCGCCTTGGGGATTCTTCAAGTCGTGTTTGTATTCGCGGGCTTTATTGTCACGAGAAGCCAGATCCCAGACTACCTCATTTGGCTATACTGGATTGACCC
GATGGCCTGGGCTTTCCGTGCGCTTGCTGTGAACCAGTACAGATCTGTTACGTTTGACGTGTGCACATACCAAGAAATCAACTACTGCGATCAATTTGGC
AAAACCATGGGCGAATATTACCTGAGCGTGTACGACATTCCGTCGGAGAAGGAGTGGGTGGTCTTTGGCATCGTCTATCTCGTCGGAATGATCCTCTTGT
TCACGGCGCTCAGCTATTTTGCACTCGAGTACAAGCGGTACGATGGTGTTTTCAGAGCTATCCGACCTGTAGcaaggacgatgacgactcGGACAACTAT
CGGCTTGCCACGACTCCCAAGGTAGCACGTCGGACGACTTCGTTCAACTCAACTGATAGTGCTGTGTTGATTGAAGTTGATACCCACTCAGACGCATTCG
TGCCAGTCACGGTGGCGTTCAAAGATTTGTGGTATTCGGTGCCAAACCCGAGCAAACCGACGGAATCCATCGACCTGCTTAAAGACATCAGTGGTGTAGC
TAGACCGGGGACAATTACCGCACTCATGGGCTCGTCAGGTGCCGGCAAGACTACCCTCATGGACGTCATCGCAGGCCGCAAGAACACTGGGTCTGTCCAA
GGCACGATCATGCTGAACGGCCACGAAGCCACGGAGCTCGCCATCCGAAGATGCACAGGGTACTGTGAGCAGACGGATATCCATTCAGAGACCGCGACAT
TCCGTGAGGCGCTCACTTTCAGCGCATTTCTTCGCCACAGCGACGTCCCCGTGAGTGCCAAGCTCGACTCTGTGAATGAGATCGTGAGCTTGTTGGGGCT
CGGAGATATTGCCGATCACATGGTGCGCGGAAGCTCTTTGGAACAGTTGAAGAGACTGACGATTGGTGTGGAGCTGGTCGCGCAACCCAATGTGCTGTTC
CTCGACGAGCCAACAAGTGGCTTGGACGCACGATTCGTGAAGATGATCACGGATGGTATCCGCAAGGTTGCGAACTCCGGGCGTACAGTTATCTGCGCGA
TTCACCAGCCGTCGTACGAAGTGTTCTCGGTCTTCGATAacctgctcctgctcaagCGAGGTGGTGAGACTGTGTTTTTCGGCGAAATCGGCGAAAACTG
CCGGACGCTGGTCGAGTACTTTGAGGCGGTTCCTGACGTACAGCCACTACCTGAAGAGTACAACCCTGCTACGTGGATGCTGGAGTGTATCGGCGCCGGT
GTCAACAAGAAGCCGTTGCAAGGTGAGGACTTCGTCCAGCATTTTAACGAGAGTGCGCTCAAAGCACAATTGGACGTGGCTTTAGAGGAAGGTGTTGGGC
GACCTTCTCCTCACGTGCCGGCACTCGTATTCGGCCGAAAGCGCGCGGCATCTTCGATGGTGCAAGTGAAGCTATTGACccagcgcttcttcaacATGTA
CTGGCGTTCTCCGGCACACTACATCACGATCCTTGGGGTGGCTCTCGGAAGTGTACTCGTGTTAGGGCTTGTCGGAAGTAGCTTATCAACGAGTTCGTAC
CAGGGTATTTGCTCTGGACTTGGaatcatcttcgtcgccttccaGTTCCAAGGGTTCGTGTCCTTCAACAGCGCGATCCCTTTCGCCTTTGACGATCGTG
CAGCTTTCTATCGTGAACGGTCCGCGCAGACATACAGCTCCTTATGGTACTTTGTGGCCGGAACACTCGTAGAGATCCCGTACGTTTTCGTGAAAGGGTT
GATCATCTCGGCGCTTCTCTCCCTCTTCATGGCTTCACGGGTGTTGCCAAGTTCATCTTGTTCTGGCTCGGTGTGTCACTCTCCGTCCTCGTGGATGTCT
ACACTGGGCACCTCTTGGCATTCGCCCTCCCGGACATCGTCATGGCGTCGCTCACTGGGTCTGTGGTCTCgaccatcttcttcctcttcgtggGCTTTAA
CCCCCCAGGAAGCTCCATCTCTGCCGGCTACCAGTGGCTGTATACGATCGCTCCGCAACGCTACGCCATGTCGATCCTCGCTGCGTTGGTGTATGGCGAA
TGCTCCACGACCCCCGAGCTGGACGCTGCAACGAGCGACTACATGACCGTCGGGCCTGAAATCGAATGCCagccgctggacgacgcTCCCGTGTCAATCG
GAAACGTGACGGTGAAGGGGCTGCTAAAAGACGTCTACAACATGCACCACGACGACATTGCACGCAACTTTGGCGCGCTACTGGTCTTCGTCGTAGTGTT
CCGAGTCCTGGCACTGTTAGCGCTGCAGTTCCTCAACCACCAGAAGCGGTAAGCGAATaacttaccggtactgtaaCTCTCGTTAGCCAATCACGGTCAG
TGATCGctgaccacttcaacttgtagGTTACGATAATCGGTAATAAATCCAAACATCGTAACAAAATCCAACAAAAATATGGTGTAAGAAAACCCAAAAC
GTACCCCTTCCCTTTTCTCCTGACCAGCCATTCCTCAATTGACCGACCGACCgacgatgtcgtcgctgcgcaACGTGGTGAAGCGGCGCGAGCACAAGGA
GCGCGggcagctgcacgagcgccgcAAGCTCGGGCTACTGGAGAAGCACAAGGACTATGTGAAGCGCGCGCGCGACTACaaccagaagcagaagcggcTC
ACGACGCTGCGGATcaaggcggcgctgcgcaaCCCGGACGAGTTCGACCGCcgcatgagcagcagcgccacggagGGCGGCGTACACGTGTCCACGCACA
ACCACCTGAAGCAGGCGGAAACGGAggcgctgaagacgctgaagaCGCAGGACCTGGCCTACCTGCACATGAAGCGCGCCGTGGACCTGCGCAAGGCCGA
GAAGCTCAATAGGGGGCTGCACTTTGTGGACGCCCCAAAGAATAACAAGCACACGGTGTTtgtggacgaggagcagcaggtggacgCGTTCGACGTCGCC
CGACACTTCGACACGGCGCCGGAGCTCGCGCACAGAGCGTTCAACCGCATCCGCAAGCGTGACTTGGAGACGGCGCAGCTGCCCGACTTGGCGGCCAACC
CCAAGCAGAAACACAAGatgcaggtggagaaggacgcCATGTACAGAGAGCTGAGGGACCGACTGGCgcgcgccaagaagatcggACAGATGAGTGCCAA
ACTGGACCTCGAACGCAAGGTGCAGGCCAAGGGGAGGAAGGTCAAGGTGAAAAGCGCCGAGAACGGCATGCCGGCGGTGTAtcgctggaagcagcagcgg
cagaaGTAGAGACAGGGAACGGACGGATGGCTGAGGTGACGGAGCATTGGGATTGATTCATACATGCATTTTTTTAGTCGACTTTTGAAGGAGGTTAAGC
TGCAGAGGAGGGTTGTTTGAGTCGTCGACGAGGAgtgtggtgctggtgatggtggcCGTACGCCTTGCGGATCTGGAGGAGAAGTTGCAGGATGACGTCG
CGACTGCCGGCGTAGATGGAGTTGGCACGGCGTAAAAGGTGGAGCGGCATGGTCTGAGCACGAGAAACAGATACGTTAGTGAGGATGGATGTGGAGGGGG
CTCCACGTTTACTTCTACCTTTTTCTGCTGGAGGATGTTCAGCGCTTTGGTGATGTTGTGCAGTGCGCTGGCTTTGTGTAGCGGTTGCTTGCCGGATGGA
CGCGTGACGCCTGGGATGCTACGCATGAGCTCCACCTTTTCGACGATGCAGCACAGTAACACACCTGACTGAAATTCCGCCAATGTCGCGCCCGAGTCCT
GCAACGCAATATTGGATAAGGTGGCAAAGGAAGTGTGAGTGAGGAGTGATCAGCACAGGTTCAAATATCCATCTCGTACGTGAAAGGCGGAGACGTTCTT
GAGTTGAACGCCCAATCGTTTCAGCCAGGCAAGGACTTCCCCGACAGGCTCTTGCGAGGACGTGGCGTTATGCGGTGCTTCAGCTGTAGGCGGTTTGAAC
GGAGAAGGCATCACCGCATCATCAACGCTGTCTTGCTTTGCTGGCTTTGCAGGGTCTAGACTAACTGTTGTTGGGGTAACAACTGCAAGATTGGTAACGG
TACGTCGGTCTAGCTGCACAGGGTGCTGCAAGTGACAAACTTACCTGATAATTCCGCTATCACAATACTTGGCGCTATTGTATCCGATTCTTGATCGAGT
CTTCTTGATCTTACAGCAGAATCGCTCCTGCCGGAATGAGTAGGCAAGATGTCGTCCTCATATTGGTGTTTCACCTCATTTTCGTGTGTCTTCGTTGAAA
CAGGATCGAGTTCATCGCTGTAGACTGGGCTGGAGAATGGAGCTTTCGGTACAGGAAACAAATCGCCGTCGTCATTATCGTCGTTTGGGTCGTTCTCACT
CCATGCTAGACGACGAGCAAAGTCATCGTGGAGTTTAATCTGGAATGACCTCCCTAGATCATCTCTGATCGCACATTTTCCGTGTCCAGCTAGAACAACA
GCTGGGAtatcaagcagcagaggagAAGGTTGCACTGGGGCCGGCCGTTTCCCACCAAGCTCGACACCTTCGGCCTTACGAGTTTCATGACGTCCTGTCG
GCGAGACTTCACCACTCTCATTAGTTTTTACCTGCCCAAGTGTTGCATGACTGGCCTGCCAGAGATGCCACAACAGCCCGTAGCTGGTCTGTCGATCGCC
AATGAGTACAGCTTGCTCggcagttgaagtgaagtAGCAGGAAGGGATCTGACCATGTGGTAAAGCCACAAGTCTTTCAAACGCCTTCGAAATGTTTTCT
CTGCCACAGTAAGAGAGATAATtagtacttaagtacacATGAGTCGATCGGAACTGCTTCAATCAAGGCTAAAGCAGCCTACCGCATCTCTGTCAACGTT
CGGGGGGTTTTGAAATACGAAAACGGCGTGCTCTTCAACACTCGGATCAACAGTGCGCTGGCATTTTAACGAAAAAAACACAAACATATCACTATTGCTT
TAACACAACAACAAGGATGATTTATGAATGAACGCTGAGATTACCTGAGTAAAACACCGTTGCGCATCGGGTCCTGCAATACCCCACGTCCCGAAGCCTA
CGTCATTGAGAAAGAAGAGCGTGAGTCAACTCGCCCAATACACAGCGTTAACCTCCCACTTAAATCACCTGTTTCACATCGAATCCGACCCCGATCAACC
ACTTGCACACCACGTGCATCTGCTCACTTGTAATGTAGGGCAAGCTCCGATTCAATGGAGCACATCCAGTGCGTGTAGGTTCCATTGCGATGGCTATCTT
TTTCCTAGTTCGAGGTGACTGGAGGTGGTTGGATCTGACGGCAATTCGTTCATCGGAATTAGTTTTCTCGTGGTCTCCGTTGACAGGAGGAGTTTCGGGC
CTTGTTTCCTCTGCGTCTTGAGTattcgaagcagcagcgtcgcgtGCAAGCCGTTCCACCCCGTCCAAAACTTCTTCTAACGCGTACCAAATCGTTTTAG
GTGAAGTTTGTTTTCCTGGATGTTGCAGGATTTCGAGCGAGCTTAGAGCTTCAGGTGAAACCCCGAGGCCTTTGAATACAGCAAGAGCTAAGGCAAAGTT
GCGTCGTCTCCCTGCAGCTGTGTTCGGGTCACTCGCGGGTGCAAAATTGTCGAAACTAAAATCCTTCGTTTCGAGAGAACTTTTGTTAAGATGTCCACCA
TGGCGCCGAatgatagcagcagcgatacGGCAAAGCAAAACGCCGCTTGAAAATACTTGCCGAATCTTCCTCGGTGAATGCAACCTCCTGTCCTCCGATT
GCTTAACAAAAATCTGCTCCAGAGACATCTCTAGACGCAAGACAAGCCGCGCCCAGTTGCAAAAGCGTGCCGCACGCGCGTCATCACTGTCAACACCCTT
GCCGCTTGAAGGCTCGCTACAAAGTTGAGATTTTGCAGTTGGGTCGAGCATACCAAACACCCGGAGTCCGTTGCTGTCGTGAACAAAGCTGGCTTGGTGG
GatattttcttcttgtcgctAGAGCTTGGAGTATTGACAGATGTGCTGGAGACTGGTGCATTACCAAGTCTTCTCTTAGCCCCAGCAGTTGGCTTCTTTT
TATCTTGCTTCGTTGTTTTAAGCTTAGCTTTTTGTTGTGGAATACCCGCTCTCCGGACACTCTTGGGAGGTTTGGTACTTGAAGTATTCACGCGCGTacg
agatcgagaagaagatgattGTACGCGCTTGAGCTCATGCTTAGATTTCACACCTTCGTGGGGCACTTCATCGGTTAAGAGCGTTCGTTGCAAGGAGTGC
TCGATCCACTTTTCTTGTGTGTGGCGTCGCCGAAGAGCGTCCTTGTCGCTCTCAGACGACTGCGTCTCAAGCATGCGCTGAACGCTCAGCCGCTTCAAGA
CCGTGAGCACGGCACAAATGGCGTCGCTCTGACCTGCCATCACTCGTGCTACACACTCTCCGTCATTTACGACGTACatggcgtcttcgtctcgacTTCG
ACATTCGCTCGCAACGAACTGGACGACGCGACGGAGACGCTCCTTCACCACGTCCTTCCCAAACTCGTCACCTTCCGTTGCGTCCTCTTCGGAGACTGTT
CTTGCATCTGAATCGTGCTTTAGTGGTCGAAACAATGCAGTGTAGACGTCAGTTGGAAGCAAAGGACTGAGTGAATATACCTGAATCGCCTCCGTACCTG
CAGCCACGCCACAACTTCAAACAACACGTCACCGAATCGCAAGTCGCGGAGTTCCTCGACTAACAAACACTTGGTCAGCGGCAGGGAGTTGAcccagtgc
agcagcaaacgccCTCGCACCGAGTCActcgcctccttctcgtcgaaaGGTGCAATGACGATGGTAGGATGCTGCATCGTCATTTGACTACAGCGCGACG
TACTTGTCATCGATCTTGAAGGGTCACAAGCCCGAAAACTGCCGCCACTTGCGCAAACGGAAGCGGGACATCCGTCGATCAAGTTGGCGGTGGAAAAGTT
GGGATGCGCTTCCACAGGCACATCTAAATGCTGTTCCTCACTGGCGGtggcgccactgctgcagctgaatCTGCAGTGACGACAGCTACTTTATCGCTCG
ACagccaagttgaagacgcATTCGGTTGTTGAGTCCGCGCCAAATGAGCGGCAAGTGAAAAGCATGTCCGACGCAGTTTCCATCTGCCAGAGCCGGATGA
GCTTTGCTGTTTGAAAGTTCGATCGCCAAGAGAGAGAGATCGCACTGTTTGCCTGCAGCACTGGCAAATCCCATTCATAGACAGAACGGAGGGAAACACG
GGTCACGTCCATGACTTGAGCGTCGGTTCTCGGTCGCCTCTTG