Description :
From Genome Similarity Track
Location :
Scaffold_134:28145- 31302
Transcript NameFunction/comments
Hyaar_Emoy2810681hypothetical protein

Sequence
3157 bases(100 bases per row)
CTGGAAGCACTTCTTACGTGACCTTAAGGGAGGCACAATCGAACAGGTATGCTTGATCACCAACGAGGTGGTTACCGAGACAAACGAAGAGCATATGACG
CGTCCTCGTTACGCTGAACCAAAGTCAGCGCGTGAAGAACGATTTGAGTAGCAGTCATGGAACACTCTCCGAGAGTCTGGGAATCCTGACTACGACATTG
CTCTTAAGTATGCAGACGTGTTCCCGGATAAGATACCGGCTGAACTTCCTGCTGACCGTGGGGTTCTGCACGAGATTGATCTCGTGCCAGGTTCGAAGTA
TTGTGTGACACGGCAGTGGCCGTTACCTCGACATCAAGTCGAGGCTATTGACTCATTCTTCGAAGGACGCCGTAAGGCAGGTCAAGTGCATGAGAGTATC
TCATCACACTCGAGTCCAAACTTCTGCGTGGAGAAGGCTACGGGAGGCTGGCGAAAATAGTGCATGCGTTTAACAAACTAAATGATGCCACTATTCGTGC
GCAAACGCCTATCCCCAGGAAGGACATGGTGTTAAACGCCATGTCATATTTAGCGCCATCGATCTAACTGATGGCTTTTACCAGATCCTGATGAGAGAGA
GCAACATACCACTCACAGCAGTTAGCACCCCGAGTGGCATGCTATGGGAATGGCTAGTAATGCCACAAGGGTTGAAGAATGCCTCGCCACTTTAAATCGC
AATGGTGTCTCAGGTGCTGAGACCATTACGGGACTTTTTTCCCAGTTACTTCGACAATATCTTCGTCCACAGTCGCGCTGAGGGCGACCTCAGCGAGGTC
CAGGTTCATCTTCAGCACTTGAAAAGAGTAGTCCAAGTCATGCGAGAGAACAAGCTCTATGCGAATCTCAAGAAGTGTGTCTTCTGCGCACCGGAAATTC
CGGTGCTGGGTTGCTATGTGAGTAAATCAGGCGTTCGAGCTGATCCAGAGAAATTTTCGTCCATCTGTTCTCAAGAACCCCACGGAATTACGTCAGTGGC
TTGGCTTGGCTAATTACTTGCATAAGTATACAAAGGACTACGCCGGTTATATACAGCCTTTATCGTCACTTTTGAAGAAAGAAGCCACGTGGTCGTGGCG
TCCTGAACATCAAGCAGCCTTCGACGCAGTGAAGAAGAGCCTGGCGTTAGCGCCAGTGCTGGTCCTACCGGACGACTCCAAGCCATTTCACGTCGTATGC
GATGCAAGTAATTTCGCGATTGGTTGTGCCCTCATGCAGTTTGATCATGAGGGCCGTGAACGAGTCGTGAGCTATAACTCACGACAAATGAAGCCAGCGG
AAAAGAAATATCGATTTCACGACAAGGAGTTGTTAGCGATGCGCTACGCACTCATCAAGTTCCGCGTTCACCTACTCGGTGAACACACGTTTGCTTTGTA
CACTGATCACGCATCGCTGCGCACAGCGATGAAGAGTCCGCACCTATCCCAGCGAATGGCACGGTGGCTTTCGATTTTCTCCGAGTATAATTTCGTCGTG
CATTACAAGCCGGGCAAGAACAACATTCTTGCCGACGCTTTGTCGAGACGTCCCGATTATGATACTCGGGCGGCGTTGAGTCATCAGGCGACTGACGACA
AAGAAGATGATGATCGTTGCACAATGTGTGTGTCGCTGAAATTAACTCGGGTCAGTCCCGAGCTGTGCTTATTCGACGAAATCGTCGCGGCTTACGCGAA
TGATCCAGACTACGCCGATATAATCGCTTATCTGCGCGCACCCAGTGACGTTGCACTGGGTGCTCTTTCGAGAACCAGTCGTGATCATATTCTGCGATAT
AGTTTGGACGGGGACCTACTCCTGTACAGCATCGATCAATTCGATGCCCCTCGTACGGTGATTGCAACGACATGGATTTTCGCGCTCGAATTATTAATGA
GTACCATGATGCTCCAACTGGTGGTCATCACGGCCGCGAAAAGACTTTCGCGGCTGTGTATCGCGACTTCTTCTGGCCCCACATGTACACGTGGGTGCGC
AGCTGGATTCGTACGTGTGAAATCTGTCAAAGAGTGAAGCCATCTCCATCGTCGCAGGCTCTCCTGCGACCGTTTCCAATAGCAACTGAGGCTTGACGCC
CAGTTTCCATGGATTTTATCTTCGGGCTCGCACCCGATAGTCAAGGCAGAACGGGTATTCTGGTATTCGTGGACAGATTTAGCAAGATGACACATCTGGT
TCCTGTTTATGCTACGATCACCGCGGCAGAAACCGCGGTGTATTTCATCGACGCTGTGTTTCGCAATCATGGATTGCTGGAGAATATTGCTTCGGATCAC
GATCCTCGATTCACATCCGCGTTCTGGACGTCACTGTTCGAGCTTCTCGGTACGAAAGTACGTATGTCAACAGCGGCCAATCCGGAAACGGACGGGCAAA
CCGAGCGAGTAAACCGAGTACTCGAAGATGTCCTTCGAAGTTACGCTATGTCCTTAACGAGTTAGAGTGCGTTCCTACCACTTGCTAAGTTTTCGCTTAG
TAATGCTGTACACGCGTCAACAGGGTTGACGCCATTTTTTGTGAACTCGGCTCGACATCCCTACTCGCCGTGGGTCGCCCCACGGCTCCTCGTGACTCCA
CTTTGGGGGGGGGGGGTGAATATGATAAACGATCGAGTGTAGCCCAGGGTATTTTGAACGCCAATGCCGTCACCCGATCCAAGGGGAAGTCTACTATTGT
GACGCCACGTGACGTGGCGTCCCCGTTAGCTCGCTGGACTGCGCAGACACTGATTGACCCGTCTTCAGCTCAACCTGTGCCTTTTTCGAAGGCCAACTAC
GCGCCGATTGAGTCGGCGCGACCAATTGATGACGCGGCTGTGTCGGAATTCAAACTCCAACGTCAAGTTATCACCCGATTTGCACGTGACACACTTCAGG
CTGCAGTGGACAAACAGAAAGAAAATGCGGACAAACATGGCAGGAAAAACATGAGCAAGTTCGTTAAAGGTGATCGTGTATTACTCTACGGAGAGTTTAA
GGGATTCGGCGGTTACTAACTTAGGTGCAAGCAAACTAGAGCCACGCTTTATAGGACCATTCAAGGTTCTCAAGGTGATTGGTGATGCCTACACGCTGGA
CATCCCCACGTCGCTGTGTCTTCACCCGACGTTGTACTTAGAGCGGCTTAAGCGGTA