Description :
From Genome Similarity Track
Location :
Scaffold_4:28145- 29605
Transcript NameFunction/comments
Physo_262607Eukaryotic/viral aspartic protease, active site

Sequence
1460 bases(100 bases per row)
CTTACCGGACTTGACCGCGCCTGCCTCGACGATCTTGGACTATGATGCGCCAAATGTGAAGAACCCCTCACTGGATCCAATTGGACAGATCAAGCTCGTC
GAGACACTGCGTCGGCATGAAGAGATCATGATCGCCAGTGGCAACGCACTACCGCCGCCTGCGTACGGCGCGGTGTGCGACATTGATGTTCAAGGCAACG
CCCCTATCAAGCAAAGAGCTCGGCGAATTCCGCTGAAATACTTGCGGAAGCTCTATGAGCTGCTGAAAGGGCTGCTGGAGGCAGGACTCATTGCGTTCTC
ATCCAGTCCGTGGGCCTCGCCGATCGTAATCGTGCTCAAGAAGAACGGCCTCGATATACGGCTATGAATCGACTACAAGATGGTCAACGCAATTACGCTC
ATTATGGAATATGCGATGCCGTTGGTCGACGATCTACTCACAGAAATGGAGAGCTACTCGTGGTTTTGTTCGCTGGATGCTGCCAGCGGTTTCTGGGCGA
TCATGATGACGATGCGTGCTCGGTGTGTGTTGGCGTTTGTCTGCGCGCTAGGTCACTTCGAGTGGCTGCGCATGCCGTTCGGTTTGAAGAACACGCCGAT
GATCTACCAGCGAATGATTGGAAACTCATTGTGGGGCTACGTGCAACCGAAAGGCGGCTGGGAGGCTTGCGCCGAGCGAATGAAGCAGGCAGAAGCTAAG
GCTCAAGCTCTACGTAAGGAGTTTGTGGTGAAGTCGCAGAGGTCGCCGAGTGTCGATCGACGCGACCTGCGGACGGTATACGAAGCGGATCACCTGGCCC
TCGCCGGAAACGACCCGCTGATGGAGTTGGTCAACAGCCCGGATGCAGATATGTTCTCGACCGGCGAACCTGACCAGTCGAAGCTGGTCCCGGTGTTCCA
CCGTCATTCGTCGACGACATTTGCTTCGGCGGGTCGACGTTCGATGAGTGCTTGAAGACGCTGGACCGACTCCTGTCGAGATTCGCCGAGTGCGGGATCA
GCGTCAGCTTCACGAAAAGCATATTCGTCCAGCCGAAAGTGGATTTCTTGCCGCATGTTGTCACGGGGGAAGGAATCCAGGCAGACGGAAAGAAACTCGC
GGCAATCGCTGAGCTCCCGTCCCCCTCGTCGAAGAAAGGAATGCAGGCGTTCCTGGGTGCCCTGAACTACTACGGGAGGTTCATCCAGGGATTGGCCGTG
TACGGAGCTGTGTTGTACCAGATAAAGGAGGACGACTTCGCACCGGGGGGTGACCTCAGCGTTGCCCGCAATGCCTTTACAGCGTTACGCCAGAAGGTCG
TCGAGGCACCGATCCTGCGGCACTTCGACGGCTCCAAGGACGTCTACATCATGTTGTACGCCAACGAGTGGGCATTGAGCAGTACGCTCATGCAGATGCA
TGCCGACTTGCTCCACCCGGTGCGGTTCTGCGGCCGGGTGCTCAAGGAGAACGAGCTCAA