Description :
From Genome Similarity Track
Location :
Scaffold_8:281398- 282663
Sequence
1265 bases(100 bases per row)
TTACTTTGATGGCAAACAACCGAGTGAAGGTCTTTGTGCGGAACTTGAGGCTGAAATAGCTCCTGTTGAGTAGCTAGCTTAAAAAAAAGTCAGTGTCCTC
GACGAATAACCACAGTTTAACTGTGCATTGAGATTACCCGCATATCGAGTGTCACGTAGTGTACTGGGTGGAGCGCTGTCGATTATCTATTCGAGATACA
AAGGTTTACACACGTAAGTTGGTATAGGGTGATAAATTTTGGGCGTACAGAGGCAGCTTCAACGGCAGAGTCTGCAGCATCTGCTCCTCCAGAGCTGGCC
TTGCTCTTCTTGCTCTTTGTCTTCTTCTTTGGTGGCATAACTGTTTGGACTTTAACGGAGGCTTTTCACTCAAAAACACTTTTCGTTTCCTAAAAAAAAC
AATGATCCCTTCGATAGTAATCATTTTGCGGTCATAATCAGAGCGAGCATACTACAGTAATATGTGGTGACTGTTAATAGCACCAGCATGGTTCTATACT
ACTGTAGTACTACAACATTCTCTTTACAAAAATGTACTACGTATTATAGTACCGGTAAATGGAAGATGCTCTTTGGACAGAAATAACACTAATTATTAAT
TTAGGCTTTAAATATTTTATATCACTCTTTAAATTATCAGTAGCCATTTTGCTCCGATTGGTTGAAAATTAAGGGAAACACTGACGTGAAAATCAACTTG
TTGGAGTTGAACCTCTGTCAGCTGACTCCACAAAATGGGACCTGCTGCTACAGGGAAAAAAATATGAAGCTCGAGTTTAGGGAGCTTCAAAATTAGAAAT
AGGGGTAATGTGGTGTACCCCAAGGCATTTTTCATTTTAAACATCGAGTTGTCAGGTTTGGACTTTGCTGCCCGCGTATTAATGCCACAATGGTACTACA
ATATACCACATCAGCACAGCTACACTTTATGCACGTCCGAGATGGCGGTGTTTATTAAAAGAAGTTCTCAATTGGCAAAGCTTCCCCATAGCCAACACTA
CATGCTACTAGTCACTACTTTTCTCCAAAGTCAGCTTTCATCACAGTCATTTATTAATAGCTGATGTCCAAGCTAGTCAATACCTCAAGCTCCATTGTTT
GCCGTGAAATATTAAACCCTGCGACTGCTTACATAATGATGTCTTTTCAGTAACATCTCGTTACTTGTGTAGCTCCATCAAAAGCAACACGGCCCGATCA
CGGAGCTCAAGATCTGCAAAGGACACTTCGCCGAGGCCAATGAGTTACGACACGACATGCTGACT