Description :
From Genome Similarity Track
Location :
Scaffold_112:28135- 32171
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_112-snap-gene-0.25HECT E3 ubiquitin ligase

Sequence
4036 bases(100 bases per row)
TGTTGGGCTTCCGTCCGTCGGCTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGATTGGGACGACAAAATGCTGCGGTTTCGGCCAAGATCCAA
ATCTGACTCAGACGAAGAATATtAGGCAAGCAAACGCAAGTCGATAGCGGAGGGATAATCGCACTGATTGCATTCAAAATTTTTGTCCCATCCACGATAA
TAAATATTATCCCAATCACTCGATCGGTCGAGCACTACGAACGACAAAAAAGGATGGGCGAGTGCATCAAAAGCTTACTCAATGCTGAAGCCCGTGATAT
CCATCTCGACAATCTATGAAGCGATTTCCGTGTGGTTAGTACCGATAGAAAGCATGTGGTAAaTCGACAACTACGTACGAGCTTCATGTACTCGGCCATT
TGTTCTTTTGAAGCGTAAGTCGGTATGTCCAGGCGGTTGAAGCACGTGTGTGCTTTTGGAAaCAGCATCTCTTGGTTCTCACCGGTGAAGGTGACATTGA
ACTGACGCACTCGCCCATCACTGCATATGAGACCCTGATCAaCGAAAATTAGTGACTGCACTCAACACAAGAGgCATTCCTGATGGCAGCTCGTACCTTA
AAGCCCTGGGCTGGAACTCGGCTCGTACCAGTTGTGAACTGAAGCAGTCGCACGCGTTCTTGATTCGACAGATCCTCCAACACTTCCCAGAACCATCGAA
TGTTCTCCAGCTCGAGTTCTGTCGGACGCCCGTCAGCATAGAACTTGAAATCGGTGTGCTTCATCCAGTCTTCAATATCAATTGTTGGAACACCACACAT
TAATAATTCGAGTTCTTGGTAGTCAAAAAGCTTCAGGAGCCCTTCAGGCACAACGTCGTAAAGGGCAGTCAGAAATGCCAACAATTGACTCGAAACGCTG
TCCAGCACGTGGTACTTGAACAACGCgTCAAGGTACGCAGTCTTGTTTGATGAGGTGACATCCGTTTCAGCGCCTCCAGGAATCAGCTCATAACTGACTG
GCTGATTGCCATCCTTGCCAACTCGAGTCACAGTAAAATCGAGACAGAACGGATCAATGTCTTCAGTTTCCTtCACTGACACAGCACTACGATAGATTTG
GTCATCCAGGAACTGAAGATCCGAGAAAGAGATCGGGACGCCAAGGATATGCTTGAGGAATGGGAGAGCGAGATGAACAGTCACGAGATGCTCTTCCAGA
ATAGCCTTGCCCAACAATCGACCAGCAAACTGGTAGTACGCGAGGTGATTTCCACGATACTCGTCCGAATACGTATTGATCCAGTAGCTCCGTTCGTCAC
CGACCGTTGACACGAACAAACCAAACTTGGGGTCAAACAATTCTGCGAACAGTAGTGTAAACCACTcgCGCATGACACCACCCGCATCCAGTGCCGGCTC
GCCGGCGAATGAAACACGCCACCGCTGGCGAAGCTGGAACGTCTTCATCGAACTAATAACTCGGAACGAATCCTCTACAATGTGGTCGCGTCGCACTGAC
ATTTCGACGTGGCCAGACTCCCACGGCAGCCACAACCGATGAATTTCTGTTGAAAACCATCGCAGCTTGTCTTGGAACGGCAAATTGTGAATGCGTTCAA
GGTTCATGATGAGCTCGGACGTTCCTGTGCCGTCCATAACGTTGATCCGATAATGGAAATCGGTCGCCACAACGTCGGACTCGTTCAGCACAAGTCTACC
GGACGAGTCACGCACGCGAATGTACCCAATTGACGTCGTACTGTCACGATCTtCCAGGAAAAATCTTGACGTCGAAAGTCTCGAGCTGCTGCTCGTGTCA
CTGCCGAtCGAGTCTCTCCGCGTCAGCGACATCCGTGTCGACTGGCGCACCCACCTATGAAGTCCGTCGTTCGTTGGCATGCGCTGCCACTGCGAGCGTC
GCGACGCCGCAAGCTGCAGCTTACTCATGGTCTCCCGCACAGGAATCTCTGTCGACTCGCTCATACTTCTTCGCTTCTGCGACTTGGCCGCCTTCTTCGA
CAACcGGGACGCGATCTCACGGTCCTGACCGCGTGGTGTTTGGCACAAGTCGCACATCTTGCGGTCCGGgTGGTTGCGGAAGCGACAAACACCGCAATTC
CACAGCGCCACCTCCACGAAGCTGTCCTTGAGCTCTTCTCGATACACGTCGGCATTCTCGACAAAGAACCCTCCATTCGCGTGCAAACTTTGACGGCGTT
GAGCCTCAATATCCGGCTCATACGCCTCGGACTCGACGCTGAAGCCaCGGTTGCGATGCACCCAACGCATAAACGCAATGATCATAaCAACACCGACCAT
TGCGATGACGGTGCCGACGATCGCTACAAGGATCGCCTCCGCCATGGTGGtctATCTGTTTCCTCTCCTGTTCTCGTCtcTTGGAGCGAGTTaGGGACGC
GCTCCGGCCGCACTTGCACCAAATCGGACACGCTCTAGCCGCTGGAGACGGATGCAGACGCCCTCGAGCCGCCCGCGACGctACAAGCCCCGTGCGAAGT
CGTCGCCGCGTGCTTCCTCCTGTGCTTCCTCCGTGGTCGCCACTCACTCGGAATGGAGTCGCATTGTCGGCGGGGGCAATTGGGGGgAAgCcGCCCTGCC
CTACCCCTgcAGCAGTCGGCAGCAGCACCGGGGTGTGCAGGGCATTTTATCAAAGGTGGGTAGATCTTGGTACAaCTGTTgTATCAAATTAAGGTaTATT
TTGGggtcAGCAcAGTCAAAATGGAAGCATTCAGATGTACCTGGTTCTCGAGAATCAGGCCATGGGGTCACGCTGGGTGTCTATTAGGCGGTTCGCTTGT
CCAAGACGGgTAGGGTTtGGTCTTGGGTGTTCAGACAAGCTGGTTTCCCGGACCGACCAACAACAAGTCGTTCGCTGGCACAGTGGTACGTGCCAGCGGA
TCCACTTGCGTaCcTAACCCTAAACAAGTGGACAGGAAACATGACTATTATCACGAAATATCCATTTTACAATCCATGCCGATGATGACGCTCCCAAGCA
AAAGaCAGGGACgCTGCAGGCTGCATCGTGAGCATACAGTAGTGTACGTGGCATACTATtACACACATGCGTGtcTACGATGGTGAGGCGCCGGTGGCAG
TCTCATCGTTCGAAGCAGACgtCGTCGGAGAGCCGA