Description :
From Genome Similarity Track
Location :
scaffold_123:28134- 29866
Transcript NameFunction/comments
g4072.t1hypothetical protein

Sequence
1732 bases(100 bases per row)
GCGCAACGTATACATCGCTTCCACACGTATCAAGTGCGTCAACTAATACAGTTGTCAGCACAAATGACGATACTGCGCCAGCACTAGATAACTCCAGCAT
TTTTTCCAGAGGAAATTTACACGATGGATCGTTTTTCATCCACCTGCCAGCACAATGAGCTGTTAGCAACCAAGGAAATAGACATGTAACCAAACTCCAG
CTTACCTAGTGAAAACAGCAATCTGGGCATTCACGGAATCCGGGTAATGGCATCCCAAAAAGCCTGCAAGCTGTTGATGAAAGTAGTGTGAGTTTCAGAA
CCATAACGATCAGAGCTATTATATCAAAGACGTACCATTCGGGCTGCGTGAGGATCGTTTGGATTCATGTGGTAAAAAGCCTCTAAATAATCGCATGCTG
GCTGGATTTCCCCCACAAGTACAAGGAGTTGCACATAATACTCCACGAACATCACTGAGTTCGGACTCAGCGCCACTGCACGCCTCAGTGCATTGCTGGC
GTGCTGATACAGAATGTGGACGCCAATACGTGTCTTGAACAAGTAGTTGGACTCAATCACCGATTCGATGCTCTCGCTGACTTCATAACCATCGTTGACG
TTGCCATCCAAGCCCTCATCGTCTTCCTCGTAGTCCACATCTTCGCGTTTCAGCATATCACGAAGCTCTTTTGACTCGATAAGCATGAGCCAGTAGCACA
AAATTCCAAAGTTTGCAAGTAACTTCGAATCACCCTCCGCGTCCGCCATCTAAAATCACCGCAAGTAATTGACAGCAATGTAAGGCATTGAACATAATCT
ATAGCGGAAAGAACTCCACCTATGAATATTAGGCAACTTACCTGCGCGATTTTATCCTGGTACAAATGATATGCCTCGTAAAATTCGCCGTGAACAACAT
GAAATAGCCACATCTCCTTCAGAATCAGTAGTTTCTGCGTGGACAAAGACGATAGCTCTTAGATTTACATCTATGACGGAGAGTACATGTAGATCGCAGT
AGAATACTTACGTCAATTCGTTTAGCATTCAGTGTAGCTTCATAAAACTCGAGCAAGTCATTTCGGTATTCCGGTTGTCGACGTAGAATCTCAAGACTCG
CCTAAGCGTCCGTAAACCAGAAACGATAAGTTTTATGTTTCCACAGAGTAACTTTGCTGGTATATAATAATTCATGTACCTCAATACACAACGCGGGCGT
CACCGTAAATCGGTGATACATCACTTCCAGCACCTTTGCTGCGCCTGCGTAGTCCCGAGCCCCCATAAGCTGCAATCACACAAGCGAATCAATCAGATCT
CCGCTGGAAGGACTCAGTATTGCAGCGCCATCACTTACTCTCGGTAACAGCTCTTCGAAAGCCATGCGCAAATGTTTAATCTGGGAATTCTTACCCCCCT
TCCGATTCCACTGGTTAAAGTACAGGTTGGTTTGTGCCTGTTCGCTGATCAAGACTTTAACCACACGGTCAAAAGTTTTCGTCGTTGGCACTAAGCCTTT
GACCAACGGATTTCTGATGCCCAAAGCGTCGTAGCCATCGTCAGTCTCGCCCTGGTCGCCGTCCACTTCTCCATCCGATTCTGATGAAGCTTCATCTTCA
GCTGCTCCTTCGAACTTGCTATCCCTGTCATTGTGTGCGCTGGTATTGGGTGAGCTGGCCGCAGCGGCGATCGCCATCAGCTCGTCGCCCTCCATTCGTA
CGTTGCAAATGCGGTAAGTTGATATTTCGAAA