Description :
From Genome Similarity Track
Location :
Scaffold_6:2813- 4256
Transcript NameFunction/comments
g773.t1POM61542.1 hypothetical protein PHPALM_29425 [Phytophthora palmivora var. palmivora
g774.t1hypothetical protein

Sequence
1443 bases(100 bases per row)
ATGAGATCTGCCGTCGCAAAGATACACACGACCAGGAGGAGCCGGAAGAGGAGGAGATCGACGAGCGTGTGCCCCATTTGCTCAACACACTCGGTAAGGG
ACTGGCGGCGTTTGTGCGGTCGTTCCCAGAACTGGAGAGCCTAGAAAAGAAGAAGCACAAACAGAAGCGGAAGAAAGTCGACGGTGGCCCACGCTTTACC
CATGCGGTGGAAGTGCTGCGCACTGCGCACCACTTCCACGACAAACTTGGCGGGTACTACCTGGCGTGTCTGTACGCTTCTCCAGCGTTCGAAGACGAGG
AGGTAAGCTTGCATTCCTGTTAGTTGATGGTAGCAGTTATGCTGATGGAGCTCTTGATAACAGAACTGCCGCACATGGCTCGAGACGGCAGACAGCTACG
GCGCTTTGGAAGACGAGTTCGACGCACAGGAGTTTACAGCGATGCATGAGAAACAGTGGTTCATGCGTCTTGCCCAACCTCCTGTTCACATAGAAGAACT
AGAGGATGAGAACGAAGGAGAAGACGATGGCGAAGAAGAAGACGATGGCGAAGAAGAAGAATAGATAGAGTAGGCTTTGCGGGTAAGATTGACTCAGAAT
GTTTACAGTCATTTTTCGGTCTCAAACGCGCGAGAGCTGTTTCCTGTTCGTGCTTTCTATGGTTAACAGGAGCAAAAACGCTGGCCAAATTATCGGCATT
GCTAGGAGAAATGCTACGTCGTTGCATGACCGAGTCTTGGCTGGAAAGTGTGCTGGAAATCCGGGCATCTTACATTTTCGCAAAACAAACAAGATCGTTT
GAACTTTCAAGCGCTTGGCCAGCGCACTTTCCGAGGCCGAGCGTTCATTGCAGAAAGGTCTCAGCCAGCAGAACCCCTCCTCGAGCCTTCATTTCTGTAA
ATTGCCTCCACAGCGGCGGCGAAGTCGAAGTATGCGGCAAGGCGACGCCGGCAGTGCATCAATGGAAGACGGGTACAACTGGATCTGCAGCTTTCTAAGC
GACTACGACGGAGACCTGCTCGAGCTCGAATTGGGCGTGGAAGGCCAGTACTTCTTCGACAACATGGACAGTCTTCTGGCCGAGTCGTCGCAAAGCCCTC
TGCAGCCCAACCACCAGGACAATTCGCCTCTACAGCTGACTCCGTTCGTCTTGAGTGTCATTGCAGGGCTCCAATCTCCTCCAACCTCTAGTGAAGCTCA
AGCCGAGACGTCGGAGCTATCAACGACTTTTCTCGCGATGCTGGGTGAAGTGCAGGCGGAGATCAGCGCCGCAAAGTCCCGAGCTCGAAGCCATCGCCAA
GTAGCGACCACGCCTCGTCGATCAACCCGGCTGCAACGCCGCCAACTGACAACGGCTGCACCACAACCACGAACGACTGCCCTGCCCTGTGTGAAGCCGA
GGACTCGCTTGAGCTCTCGCAAGCAGATCAAGCGCCGCCTCTT