Description :
From Genome Similarity Track
Location :
Scaffold_53:28126- 54895
Transcript NameFunction/comments
Phymu_g2825fat-free family protein
Phymu_g2826hypothetical protein PHYSODRAFT_505033
Phymu_g2827ATP-dependent RNA helicase dbp4, putative
Phymu_g2828hypothetical protein PHYSODRAFT_510256
Phymu_g2829hypothetical protein PHYSODRAFT_510279
Phymu_g2830hypothetical protein PHYSODRAFT_561505
Phymu_g2831hypothetical protein
Phymu_g2832hypothetical protein PHYSODRAFT_302198
Phymu_g2833hypothetical protein PHYSODRAFT_507552

Sequence
26769 bases(100 bases per row)
ATGGAGGACCACGGCATGAACCGcatgcaggagctgctgagcagCTACTACGGCCTGCAGGACCAGGAGAGCAGGCAGGAGCAGCTGCGCAACATCGACT
CTCCCGGGTTCGACCCCAAGATCTACGTCAAGGTGCGTTCCCAGCTGTCCAGAATCCTCTAAGACAATGTAGGATCCTTAACTTTATTCTGTTGTGtagg
agctactggagacCCGCGGGCTGAACGACTTGTTGACGACGGATGACCAGCTGATCCGCGAGATAAAAGAACTGGACACCAACATGCAGATGCTCGTGTA
TGAGAATTACAACAAGTTCATCAGCGCCACGGACACGATCCGTAAAATGAAGGTCTGCTTTTcaatgtaaaaaaaaacgagaAACTCCTCATACTGAAGA
GTTTTTAACGCTATTTTCTGGTGCAGAACAATGTGGCGAgcatggaggacgaggtaGGACGTGTCGTCAAGAGCATGGACACGATCACAGCCAAGAGTGA
AAGCATCAATGTGGCGCTGGCGCCGCACCGctccaaggtggagaagctcatcgGGGTGCGGCGGTTGTTAAAAAGATTCGAGTTTATCTTCGAGCTGCCG
CAGAGACTGAATACGTGAGTGGGGGAGAAGTGCGTGGATTTTTATGTGAGAACTGACTATAAGGTGCAGTGCtgtgaagcagaaggagtaCGCCAACGCA
ACCAAGTACTACCTGCTGGCCCGCCGAATTCTGGGGAGATACGAACATATCTCGTCGTTTAAGGTACGTTGACGATAGAATATTGTCGGTATTACAGTGT
TTTAACGGGCTTTGGTTGCTAGGCAATTCAATTGGAAGCTGAGAAAATTatccaacagctcgagcgaTTGTTGAAGAAGCGGATGCTTGACACAACGCTC
GAGTCAGAAGAGGTAGCGCTGAACATGGATTTTTATATTATTGAGCGTCAGCTGAACTAGTCTTTCATGCCCGATTAGCTCTGTGAGACAGTggttcttc
tgcatcaactAGATGCTTGCAACGATGAAATCCGTGACCAGTTTCTGGAGTGGCATCAAGCGTACTTCGAGCGAGCGATTGTTGTCTTTAAGGTAAGCTA
TTTGATCTACTGGAATATGTATCATTGCGTTTCCTCGATGCTTACTAACGCCCTCGATTTAACTTCTTCAGTCTCAAGGCACGGCCAAATCCGTCCTTGA
CTTCCTTCAGAGATTCAACAAGGACGTGTTGACGAAAATGGGTCGAGTGTTTTCCGTATACAAAACCCACTTCATGCCAGAAGTTGTTGCACGGGAGAAA
TCCTCAACGTCCCGAAAGTCCTCTGATGCAATTCGAGACGACTTGTTCCTCAGCTTTGTGAAAGAGCTCTTCGCACTGTATTTGGGCGAATGTGTTGTTC
AGTTCCGGCGCCAGCACACTGATTTTGTAAGTTCACCGTTGATGCATTAAAAAGAGCTTGAAAATTAATTACTCAATTCCTTCTTTTGGACAGGGATCGA
CggaagaagttctcgaaACGTTGCAGGACGATGACCTCTCGGTAGACATTGTCGAAAGCGAGTACTTTGTCTTTATGCGGGTGATGAAGCACTTCGTTTC
ACGTGTGAAGGAAGTGGATACAACCATCCCGATGTGCGGACTGGCCGCAAATGCCACtgaaatggtggagaactGCGTTCGCTTCCAGATTGAAGGCGTT
TTCCAGAAGCTACGTGAGGATACGGGGGAGTTGTTTGTTACTTCTCACGAAGATGTGTGTGGTTTGGCACGCAGCTCGCGTGATGGAGGACATAGTGTTC
AACCTTTGGCCCAACAGTCGGCGAGGACGTTCACTGAGATGATGCAGAAGGTGCTACAACAAATGGAGCCAATGGTGCAAACGGGTTTTGCGATTCTCTC
GGAGCTCAGCCGACTCTTCTCTGACCTGGTCCAGAGCCAGTTTTACGATTTCCTGAAGTGGTTTAACGCGTCAGTGCTCCAATATGCGGAGCCCAAGCGT
GCATTTACTCAAGCTGATAGACCACAAGTCGAGGAACAAGACAGTGTAGTACTTCCGTGGTTGGAACCAAGTCCTCAGTTCTTGCTGTTTCTGGCTTGCA
TGTGCCAAGAGCTGTCGGCTGAGGGAATCGGTGAGTGTGTCCGTGGTCTCATTGAGTGCTTGCCGGCCCCTCTGTCTCCCTCGAAAGCCTCTGAAGCAAT
TGGCAGTCGCCGTATGAACCAGCAAGATGTAACGCACATGATTGAGGTGACCCGCGAGTCTTCTGcagagctcctgcagcacgttgctAAGCAGTATGGC
AACCAATTGTGTATCATTGTTCATAATGGAGTAGCTGCTACGTCATGGGCTGATATGGACGAAGAACCGAGAAGTGTGCAGGAGATGATGGCTGCAGTTG
TTGAGGCGTCTTTCCGGTTCGGAAAAGAAGTTGCTTTGGCGCTTGGCGACGAACAGAGCATTTTTATCGGGAATAACAGCCGCACTACAAGCCGCGACTT
CCGCCGACGTGCGAGCGCCTTGCGGTCTCGCAATGCGGGCGTTGCCTCCGCTACGTCAGGTATGCAGCTCGATGTGGATCGGATCTTCGCACGCAAAATC
CACATTTTTCCATCTCAACTGGAGCTTTCGGCAGATGCTTTCGTTCAGGTCATGCTCAAAATGTGTATCAAGGCTTTCAGCGAGTGGGTGAGGACGCTGG
AGCTTTCAAAGTTCGGACTACAGCAAGTTCAATTGGATGCCGAGTTCTTGCGCAGTACGTTGATGCACATTGTGGTGGCTGGCGAggccgaagaggaagt
ggaaaGCCTGCTGTCCGACTTGCTTTCAAATGCTCGAGCCCGGTCGTTGGAAGACGTGCTCATGGATCAAAGCAGCGTCGTCGCTATCGTGAGCACCAAG
AGCACTCAAGTTCTGTCACGCCGAGGCTGATTGTAGCAGGATCGTCTCAATATGTTCATTCACCAATATCTCGCTTGCTTACAGTGTCTTTTGTACTAAC
AATCAGTTTTGGTGATCAGATAGATGTGCACTGGGTATGCGCTCTACAAGGCTTCGAGAGCTGGATCCACGAACGTAAACCCTTGCGAGCTCTTCAATCT
CCGTGGCTTCGCGCTGAAGTTTGTCCAGTTCGGCCTTGTAGCGCTCCCGATTCGACTCTAGCGAGTCGGCGTACACCCGTACAGCAGGACACAGCGTGGC
CAGTGGCAACCAGATTGGACGCAGTACGTAATTGATGAAGTTGAGCTGAACGGTGACTCGGGTCTTGGCGTGGTGCAGATTTGTCATGAAAGAGTCGACG
GGAACGTGAAGTTCGGCTTCGTTCTtcgcttgctgctggaactcagAGAGTATACGCATGCCCCATCGAACTGCCTGCGTGTAAGGCAGTGCCTGGCCAG
ACAAGTCGGCAGCATGGATGATGATGGCCATGAAGACAAAGCGATGTTTGCTCCGGCCTCGTCTCGTTCCTCTGCCCCCGTTACTGTtgacaagaagatg
gcgttTCGAGAGACCTTCGAGTGCCTTGCACTTCTCAAAGTGTTTGGCCATGTCTGTGGCCAAGATGCAGTGGATGAGCAGTCGGCGCATGTATATGAAG
CAGGCGCGCGTGGGCAGTCGAGCGAGGAGGTTTGCTCCTGGATGACTCAAGATAATGAAGGCAACGCGACAGTGGTGGCGTTCTagaacggcgtcgtcgt
tgtGTGTGAGCGCAAGCTGGCTATGGGCCTTCACTTCGAAGTCGTTCGTATTCCCAGGGTGATCTAGGTCGTGACACAGTGCAGCTACGAGCATGGCGAA
GATTTCCATTCGTGCAAAGTATGAGTGGGCGACACCTGACCGACGTAGCAGACAATACGTCGCGTGTGTGACTTGGAAAGCGTGTTGAAGGTTGTGGAAG
GCATTTTGACGATAATGAGACGCCACGTGCGAAAGGAAAGTGGAGAATGTCTCTTGTGCAACCTGGAAACGCTCCAGCAACCCAAGCGAGCGGAAGAGCA
CAGATGTCGCTGCGTAGATGTCGGCATTGGACAGATCAAGACAGCTGAAGTCCCAGCGCGTCACGTCTCCAACGCCTATCACGTGCCCGTTCTCACGAGT
TGTGGAGAAGCGTCGCTGAAGACTCCGCGGGGGAAACGGGATAGCAGAAAACGGAGTCGTtacgcgttcttcttcgtcggagTCACTACTGTCATCGTCG
TAGTCGTTTTCTTCGTCGGATTCTTCGATATCGTCTGGGTCGTCagcagtggctgcagctgccacTTCTTCCAGAGCGTCCAGTTCGCTCGATTGACAGA
ACTTTTGCACTATGGACGAGATGATTTCAGGCTCATTCACGTCACTCAGTTGCTGTTCCTGCGCTTTCGAAGCATCAGTCGATTCGATCAGAGGCTCACC
TGGCGTACCGAGCCCGCAGTCCGATACTACCTTGTAGTACGAAATATCCAGCGACAATCGACCTAGCGCGAATTGGATCTCTCGACAATACTGGGCCATA
CATTCGGCATCGTTGACAGTGAAGGGCACGCCGTGTCTGAGAACGCgtcgctcgtcgtcgtctctCTTGTTGgtatcatcgtcatcttTTTTGTTGATGG
CCATAACTACCGCCACAATCTTGGGGTTAATTGGCGTGTGGTCTTCGAACACTGGCATTCCAAGCACGGTTGTGGTGCGGTATCCGGTCTTGCGATCCAG
GGTGGGATCAAAGTGAGAGTGCGTGTACGCGTCACGCGTGCAGATCGTCTTCCCCGTCGTCGCGATTAACCCCGAGAGGCCGTTGGTTAGCGGCATTCGG
ACACTTTGGCCGTCTTCTTTGGTGATCCAGAGCTCTTTCTTCAGTGGATCCACCAGTAAGAAGCCGAATCGGTCGCAATGAAGCAGCTTTCGCCCCTCAG
TCATTACGACACGCACAAACCTCGCGACggaggcagcagcactcgTCTCGTCCTCGGGTCCGTGGTTGGAACTGTACGCGCGTTCTCCGTTGCTGTTCAC
GAAGTCGGCAAGTTGTAGGCGCGCTTCAGTCAGTCTCTGCGACATCAGCACAGAGCGCAGCAGATTGGACTTGTGCAGTGAAATccctgcagcttccgcg
GCGTAGTTCAAGTACAACGCATCATCTGCTGTGAACTCGTCGCCGTCAACTTTGTTGGTGGCGCACACGACGGCTAGAACTTGCCCACCGGCATCTTTGA
CCGGCGCACAAAGCACctgcttggtcttgaggGCCGTCCACATTTCGTCGAACTTCGGGTCGAACGCGACGTGGCTTGGGGCGGAATTGGTGAGGACGAG
CTGTCCAGTGCGCAtgacgacgccgacgatgCCATTGTGCGCTTTCAAGAACGTCTCATCGTATTCCGCGTGTCGTAGCTGTCCCTGGGATTGACGAGAT
CTTTCACtggccttgtccttgagTTTGCTCCTGCCTTTGGCAGCTGTGGTCTCCACAGGGACtctctcgtcgtccttgtaCTCGCTGACGAAGAGGTAGA
ACTCATCCGTGCCTTCATCGCGCACATACAGTGCGATGTGCTCGGCGTGTAGCAGCTCATAGGACACGGTGATGATCTGGTGAAGCACGGCAGACGCGCT
GACTTCTGCTGCGATGTTTCGGTTGAGTTTAAGAAGACACTCGATGCGACTCTGCATGGCCTGATGAGCTTTAGCCAGCGACAAGTTCCACAACGCCGTC
CCCGCAGTCACGCAGATGTAGTCGAAGCTCTCCTTGTCGCGGGCATCGAATGCTCGTCGTTGTTGCGCCTCCTGACTGCGTCCAAGTCTCGCTAATGCAG
CACGAGGGGTTGTGGAGAACCACAAAGACTCTGGAGGGGGTGCTGGCGGGGAGTGGAGATCCACTTCCGGCAGGATCTTACGCGTGATGACCTGGAAGAC
GCCGACTAATATTCCGTGGACGTTGAAAATTGGCGCGCAAAGCAAAGCCTCAGGCTCGAACTCCAGTAATTCCATTTGCTcttcgaagacgtcgacgacc
tCGGAACCGCTGACGTCCGCGACTTCGAGGGGGGTTCCAGTCTGCGCATGTACATGTTAGTACACGTGGTTAGATTTTGTATGGAGATCCGCAGAAAGCA
GTACCTACTTACCAGAACAACGCGTCCGAACGTCGTGGCCGAATCTACCAGGACGCTGCCTTCTTCGGTAAGGTAACGTTTACCAGGCAAATCCATCGGC
GGATTggagaagagctcgacgCGGTCCTTCTTCTCATGTAGGATGCCGACCGTGTACTTCTCTGCTGGTAGAACGTGTTGTGCAGCACGAAGCGCGTTGC
TCACGATGTCCAGACTGTCGGAGGCTTGCGAGATCTCACGCATAGCGTCCATGAGTGCTCGGAGCTGACGACGTCCAATACTTCCGTGAACAACTCAATC
TATTGAGGACTGCAACCAATACGTACGTTTTCTTCTCGCTCCGTAAGCTGATTCAACGTCTCGGCTTGTTCTCCGATGAGGTTGCGCATGCTGCCGGCAC
TGCTAAACATTTCGCTCTTGGGTCGCGGTCGCTTCGGCTGCGTGGGCTTGAACAACTCACCCGGACGGTACGGGCGATGGTCTGCGCGGGTGCCGGCGCA
GACGTCCAACTGGTGTTGCCGCTTGAGCAgtttgagctccagctccctcgcctcctcctccgcctgcCAGAGCTCCACCGACAGTCGCCGATTCTCATCC
AACGCCGCTCTGGCCCCGTCCATAGCAACCTTCAGCTCCCGTACGGGGACCcgcaccagcttcacctcatcgtcttccatTGCTAAAGCGACAATGCAAA
AAGTAACCACCCGAGAGTGTTGAAGTTTTTGCCTCGtcacatggctacatgtcACTGATATGTCACTCTATAGAGGATCTCTGAAACTTGGTAACGGTTA
ACCCTTTTAAAATTAGCTTAGTGGCCAGCCATTCGAAAGAGCTCAATTGAATTCCAGGCAGCACCAGTGCCAATGGCTTCGCGTGCGTTTCGCCAGGCCC
ATAGCCGGCCGAATCCTCCGGtgcaagatgaagaagcagccgcagcagccaacgctgCTAAAGTCAAGCAAAATGAGCGCGAACGTCTCGAGATCGAGAA
ACTTGAGGCGCGCATCGCCGAACAAACTCCCGCGCGCGGCTCGCAGCTCGGTGAAGCCGCCAGTTTCGACCTCTTCCCGTTGTCTGAAGCCTCGCGCCGT
GGACTGAGATCCTGCGGCTTTACAGCGCCCACAAAGATTCAAGTAGGAGCTCTGCCGCACGCTCTGGCTGGACGTGacgtgctggctgcagcgAAAACAG
GCTCCGGCAAGACGCTGGCCTTCctgctgccggtgctggagaagctcttccgtATGCGTTGGAGCGTGGAGGACGGACTGGGAGCGCTTGTCATCTCGCC
CACGCGAGAGCTGGCACTGCAGATCTTCGAGGTGTTACGCAACGTCGGCAAGGCCCATGCGTTCTCGGCTGGTCTGGTCATTGGAGGCAAAAACTTCAGA
GAAGAACAAATGCGCCTCATTCGGATGAATCTGCTGATCTGCACACCCGGTAGACTACTGCAACACATGGAGCAGACACCGGCGTTCGACGCTAGCAACC
TGCAAGTGCTGGTACTGGATGAAGCAGACCGAATTCTGGACTTGGGTTTCCAGAAACAATTGACAGCCATCTTGGAGCACTTGCCgcctgctggagaacg
acaaACGATGCTGTTCTCAGCTACGCAGACCAAGTCTGTGAAGGATCTAGCGGCACTCAGTCTGCAGGAACCAGAGTACGTGGCAGTACACGAACACTCC
GCTAACGCGACGCCTAAGGGCCTTTCACAGAGTTACGTCGTCACGCCGCTGGAACGCAAACTGGatgtgctgctgtcgtttATCAAGTCGCAcctgaagc
agaagacgattGTCTTTTTGTCCACGTGCCGTCAGGTTCGCTTCGTGCACAGTGTCTTCTGTAAACTGCAGCCGGGTATCCCGCTGTGTGCGCTGCACGG
CAAGTACAAGCAGGGGAAGCGTGTTGAGGTGTACTACGAGTTCCTGAACAAGCCTGCCGCGGTGCTGTTTGCTACGGATATTGCTGCGCGTGGTCTGGAT
TTCCCTCAGGTGGACtgggtgctgcagctggactGCCCCGAAGACTCGGCCAACTACATTCACCGCGTCGGCCGTACGGCGCGTTACAACAAGCAAGGTA
AGGCTCTGATGTGCCTCGTGCCGTCAGAGGTGGACGGCATGCTGAAGCGTCTcgaggacgccaaggtgcCTATCCGTgagacgaagctgaaccCCACCAA
GACCACGAGCTGCCGTCAAAAGGTGGCGTCAGTCGTAGCTGGTGACAAGGAAATCAAGGCATTGGCACAGAAGGCGTTCATGTCGTACGTGCGCTCGGTC
TACCTGCAGCCTGATCACGAGGTGTTCAATGCCACTTCTCTGCCtctggacgagttcgctGAGTCGATGGGACTTCCGGGTGCGCCACGCATGCCGTTCT
TGTCCAAGATGAAGGCTGAGCATGAGAAAGGAGGCAACGAAGCTCTGCGTGAGGAACTTCGCGGAAAGAAGAACGTCAACcggaaactgcagcagctcaa
ggagaagattaaggcggagaaggagcgcaagcgTTTGGCGCGGCAGCTGGCTGCTATGGACCCTaaggagcaggaagaggccaagaagaagttggcgcag
aagcagcaggagaaggagaaagagtctgacgaggaagaagaggaagaatCACTTATGGTTGTCAAGCGAGTACACAACTgggatgaagatgacgaggagg
agattgaCCTGGACGCGCTTGGGCCCAGtaaaaagaagcagaagaagctgcgcgtgGACCGTGAGGCCATCAACGCGTCCAAgatcgtgttcgacgaggA
AGGCAACAGTGCTAAGATAGCGGACCGTCTTTCGGCACGCAACACCGGTGACGCCGAGTTCGCGGACGTGGAGAAACACGCCCAGGACTACACAGAACAG
GTGGCTGCTCGTCTCGCTGCCAAGGATGCCGAGGATCGTCGtctcgagaaggagcgtgTGCGTGCCAAGCACCacaagaagcgcatgaagGTCAAGGGTG
AACGCGACGAcgagagtgacgacgaaggcgcACGCCTTGTTGTGGGCTCTGAAGACGAGGACATGAGCGGATCTGgcagcgacagtgacagcgGTAGTGA
GGACTCGAACGGgagcgaagacgacagcgacgaagacgtgagcgacaagaagaaggtcgacCGCCAGACCGTCGCCAGCCAGGAAGAGATGGCGTTACGC
ATGCTGCAGCGTCGGTAGATACTCGAACTAACCCGCTTGACCATACACTCACACTCTTAGATGCACACCAGTTACTTGTGTCGACGCTTTGTCATCGGTG
GTGGTACCTTcttttttgctgcttggaggaCGTCACTCCTCATCATTCCGTCCCTTTAGCGTCGATTCCATGTCGGACGCCATTCCTCCTACTTCCAAGC
ACCCGCTGCACCGCCTCCCGAGTGGGATGCGTGTGCCTACATCTGATGGCTCCCCGACCTCCTCCTCTACCCGTCCACGCCGTCGCCGCGTGCGTGCCGT
GGCCATGATCCTTGACGACGTGCTGTACGACCATTCAGGCCTGTTGTCACACTTGGCGACCGACCGCGGTGTGGCTCAATTGCTGGTGGAGGGCGCGTTC
CCGACCAACGCCGCCGCGTTTGAAGCGTTGCAGACCTTCCGCAACGCCTACGGACTCCGTAAACGCTTCCCCCGCTTTGTCGACAGCCTCGTGGGTGGCC
CCCAAGCCAAGTTGTCGCCGGCACAGGCGCAACGGGTCATTGCAGCCTACTACGAGAGCAATGTACCCGAAGCAAGAGGTATCACGCCCTTCCCAGGCGT
AcgcaagacgctgttggagctgcaagacggCGGTGCGTGCCACTtggcgcttcttctcatcGGCAAACCGGAAGTGCAGCGTGAACGGCTCAAGGCTCTG
GGAGTCGACGACTTGTTCGACCAGGTGGTTTATGTGAGTCCCAACCCGAGCTTAGCGCAGGTCACGAGCGCTATGAAGCAGCTCACAAGGCAACTGGAAG
TGCCGTCGTCTGCTGTGATGTTCGTAGGCCGCAAAGCTTTCTACGAGATCAAGGCGGCCAATACGGTGGGAATGCTCACTGTCCGCATGgtacgtggaga
agatcagTGAATTGTGTGTGCAAGATGTTGACTGGGTCGCTACTGCAGTTGTTCGGCAAGTATACAAGTGTGATGCCTACAGATGAGATGGAGCAGCCAA
ACTTCCAGGTAAGAAGAAAACTATTTACCTTTCGTACCCTTTTCATGCCTCCCATTTCTTGTGTTTGGCGTTAGATTGAGTcgatcgagcagcttctgcc
gATCGTAAAGCTGGCAGACCAGCAGATGCTACAGCCAAAGATCGTGGCAATTGGGGGTGGCACAGGCTTGGCTGTACTGCTCAAGGAACTGCGGCACTAT
CCGGCTGACctcactgctgtcgtcacAGGTACGGTACGGATTGTCAAAAGTGACGTTTTAGCAGTTTGATTGACCAATTCTTGCGTAGTATTTGACTCCG
GCCGCCACTCTGGTGCTCTTCGCAAGTATCTGGGCATTCTTCCACCCGGGGACATCCGCAATTGCCTTGTGGCGCTGTCCGACTCCGGTTCGTAACTTGT
TTTTCTTGAAAAGTCAAATATCTGCCTTCTCATAGCATTTTCTATTCATTTGTAGACGAACTTCTTAGCAAGTTGATGAACTATCGTTTCCGAGAAAACT
TCATGGAGGGATGCAGCTTGGGGAACCTGTTGCTGGCAGCGCTGACGGATCTTCAGGGCGGCTTCGACCGTGCTGTCTCGTCAATTGCTGATATCCTCAA
CATCCATGGCTCCGTGCTGCCTGCTACTCTTGAAAGCACCGAGTTGTGTGCCGAGCTGACTGACGGTTCTACGGTCGTCTCGGAAGTCAATGTGCGTAGC
CCTTTCATCCCTGACGAAAACGAACGGCCTCATTCCGGTTCCGAGTCCTcgacaagcagcacaagtggaacgccaccagcatcaccacCAAAGCcagaga
acgagaagatcaagaaagCTCCGATAAAACGAGTATATCTCGAGAACTCGAACGTGGAAGCCTTCAGTCCAGCAGTACGCGCCATTGAAGACGCTGACAT
CATTATCCTGAGCCCTGGCGGCTTCTACACGTCCATTATCGCCACACTTTTGGTTCCCGGAATTCGCGACGCCATCGCTCGCAGCGCGGGTGCAACCGTG
TACGTGAGCAACGTGACGACGCAGAATGGTCAGACGGACGGGTacacgctggagaagacgcttGATGTGCTTTCCACTTATCTTGGAGCCAACGCCGTCG
ATTATGTGATCGCCAACAACACACATCCGCCGGAAGACGTGCTGGCTCCGTACGTCGAGCGCGGCGAAGAACTTTTACTGCCTACACCCGAAATGGCAGC
TAGTGAGCACCCTGTGTTACTGCAAGGCCAAACTTTCCAAGAAGATCTGGTCGCTGGTCACGTGGCACGAGAGTGGAAGAAAGCGCCGATGCTGAAGCAC
AGCGGCCGTCGCGTGGCTGCCATTCTCTACACTATCATCGACAAGGAGATGGCACGACACCGTCAACATCAACAAATTCCCAGCGTAATTCCAGTAGCTG
CAATGGAGTCGAAAAGCTCGTGGTCTTCGCGATTCACAGCATCAACTACAGTGCTTGGAGTACTGGCAGCTACCACGCTCTTGGCCTCCATGCTTCGTCG
TTAAACACGAAATAAACAGGAATCGACAGTAAATATCAAGTTGTTTTAGCACAGCAACGATATCTCACAACGCACTACAATTCATATCAACACATACGTT
TAGCGTACCAGACTTATTTCCGCGGCAGTGAAGagacagaggaagaggaggcagtagaagctgtcgaagaagacctTGGAAGCCCTGTAGTACCGGTCGA
CTGTCCCGGATGCTCCTCAAAGCCATGGTGAGTCACCATAAATTCCGAGAAAGCTTGGGTAGCGATGAACTGCGTTCGGAACTCGCGCATTTCGGGGGTA
GAAGCAGCGAGATAGCTGGCCTcatcgaagaagacggtgcgCTTGCGAGCAAACTCGTCCGTCCAGACATAGCGATGGTAGCCAAAGTCCCCGATGAGCT
TGTTCACTGCGCGGAGGAAAAGCCCGCGGACTGCGACTTCCGGGAAGACGAGAGGTTTGCTAGGGAAGTGGTGGGCGAAGACATGATCACTGCGACTCAC
GTTTGGCTTCAAACACTCGTAAAGTGCGTCTCGTAAATCAAATCGCACGCTATCAGGAAGTGAGCACGGCACTTCTCCACGTAACACAGCTCCCTTGTCT
AAGTCCACAACCAACAGTTCCTCTCCAGCCCCTGCGAAGAGATCATCCCCGCCTTCCTCGATGAGTTGGCGCTGGGCATCATCGAGCGCTTGCTTCTCGG
CGCCAAAAATGAACGGAGTCGGGCACTCAAGGTACTGTAACATTCGTCGGGGAAGCACAGGAAGATACACATGCGGCCATGACAACGGGTGCATAAGTGC
TCGCAACGATTCACCAACCTTCATGAGCACCGAGAGGTACGACGACACCAACAGAATCCGGTTCTCTAACAACGCTGCAGTAAACACAAGGAGGACGGTG
GAGACGTCCAACGTGTCAAACAACAGGCGCACAGAGTGATCCAAacgtggaagagcagcaagcaaCGAGGCGGCTGTGGCTCTTGGTGTCAAACCCGAGG
CCTCGAGCAGAGGTGACTCTGGAAGTGGTGATGGCTGGTGGTACTGCGAAATGTGTTCTTTTGAGACGGAACGCGTCAACTTGGCAAGAACCTTCTTGTC
TAGCTGAAAGCCATGCTCCCCCTTATGGAGCACCCCCTtagcagctgctgcagtagcaatcgtctcgagctcgaggATAAACTCGTATGCTTCAGCAAGA
CGCTCTCGGAGAAGATCCACCATCGGGAACTTGGACAACACGCACACTCCGTAAGGAACCCATCGACATCCACCTGCAGAATCCATTCGCGAGCTCTCAA
GTGCTCGTCTTGATAGTGGGGGTGCTGGCTTATACAAAACCACACAAGCTGCGAACAATTCGGCAGCCGATGcgccagcgctgctgtctccCATGCGAAA
GTTGAACGCCAGAGGTGCAGGACACGATGGAGCTGTAAGCACCACATGCCTGGGGTCTGAGCTCCAGGGGACGAGGAAGTTTTCGACGGATTTATCCACG
ATATGAGGTGTGGGGTCATGAGGCAACGGATGTTGCACTACCAGCAACTCGATCGGGTCATCGAACACCCCACTGCCCTCGTCAgcagtttctgcttcgt
TGTCTGGCATGGGAGCGGGCACAGCTTCGAACGTGAGGACACCCGAGATGGCTTCGAAACTTCGCGCCGTGCGAAGCGAGTCCAgggttttcttcttcgg
cgcTGTGACTTCAGCGTCACGTGAATTGGATGACAAAGACGACGTCGAGCCGTTAGAAGACGATGAGCTAGAGCTACCGCCAGCCCAATGATGCGCACGT
AATCCGTAGCTCAAAAGCAGTGCTGAAAGTCGCATGGAGTCGTCGATTGAATCCTTTTCGTCCTCTGGTGAAAGCTTCGGGTACAGCGCGAACTCGGCGT
ACGCACGGCTCGTTAAAAAGCGGTGATACAGCTCCAAGTGAATGAGACTAAACTTCGTCAAGATCGCGTCTTGTTCAGCTTGAAGTCGAGAACAGGACGT
CACTAGCGTGCGGGAAAGTGTCTGCATCTCAGCATCTCCGGCATAATATTTCTGAGAAATGTACTTGAGCAACCTCCTGCAGCGATAGGCAGCCTGCTCT
ATGCGCTCACGACGCTGGTTGCTGGTtgcactgctggatgagGTGGCTCGGGAGCTGCCACTagacttgagcagcgacATATAAACGCGGAACGCCGGCT
TGAACTCATACTCAACGTCCAGCCATAGCGCGATCTCGCGATGGTAATTGTGtgggaagaggaagatccagaagaagttggcgaAACGGTGGTTCATCAG
AATGTCCTCAAGGCAGATGACTTCTCGCTCCACAGTCTTCTGCATTTCAGTGTACAGTTCCGTCTTTCGAAACTCCGGGAACTTAAACATCAAAACTCGC
TTCACCTTCACCGCAACATCATCGAATGTCCGTAGTGCATCTTCCCCGCCAGCCGCCAGGTCACGTTTAATGCAGCGCAGTTTATTGGAGTCCACGATCG
GAGGCTCGCCACTatcaccttctccatctgaAGAGCCATTGATGGGGAATTGCGCGTTCTTCGCCAAGTATTTCATCGCAATCTTGACGCCGTACGTCCG
CAACATGAGCACGTCATCCTTCGCAAAGGGTTTCTTCTGGTAGTTCGCACGCAACGTACACCAGAACTGCCGGTACTCCTCGAATGAACAGAGAAAGAAT
AACTTACTCTGGTCTGCTGGGTCGGGAAGCCACGCAGCGTAATACCGCATCATACGCGGGTTGCTAATGACCTCTTCAATGGAAATAAGCGTCGTCGGAT
CTGGTGTGGGTTGGTGCGCTGGGAACGCGAATTGCTCTTGCTGTCGCTGTAAAACCTCGTCCTTGAAGGCACGCTGCATTACTTTGCCGAAATTGTGCTG
GTACTGGTCGTGCATCCACCTGTTCCACTTCTGAAACTTGGCACCGCCGTTCGATGCTTGTCCAAAAGATGGTAATGGGGGCAATATTGAGTGATGGTgt
gttgacgatgacgacgcgaCCGACGACGCGCCTGACATGGCTCCAAAACCACTCCCGCTACTCATTTGTGCAAGGATTTGCTTCTGTTTGTTCGCCCAGA
TCTCCGCCGACGTGGGTGTCGCCGAAGTCATCgtgccattgctgccatcgctaGTGCGAGACGCTCCCGTTTTGTTGCCCGCCACAGTGGAATAGAGGAA
GCTTCgtgccttcaacttgacaTGTTGTGCCCACCGAGACTTGGCATTTTCAAGCTTGacatcctcctcttcctcctttATGCTGGTGACTTCATAGCTG
TTGACATCTTCATCCGACCCGCTGAGCACTTCCGACAGTTCCCGTACACTGAGCTCCCGTTCCGGTTCGAATAGATCCGTCTCATACAGCATCTGCTCCG
ATATGGTGCTCCTCCGAAACGTGCTGCGActcgagaacgagaaggcCAAACTGTCTCGAGAATGCCTCGACATAGCCAACGAGTCTCGCTCATTCCCCAA
ATTCCCCCCCACGGCAGTTGATCGTCGTTGATGCGGCAATAAAAAATCGTCTTTGTCTGTATACAGCGATGAACTCAGGGCACTGGCCATGCTCTCCCGA
ATAACTTCCTCGGCTGATATGGTCGAATCTGGTGGCAACGGCGGACTCGAATCCAACGACGCTAAAtaaacaacaacaagtcATTAATAATCAGCCTCAC
TAACACTTCGCCTGTGTCTTCTCTGCAACGTACATGCTCTTCTGTATCTCTCGGCcccgctgcttctcctcccaGAGGTGGAGTCTCCCAGCATATTCCG
TGTCAATCTcccaccgtcgtcttcctcatcaaAGCTCAtcgttcgagcagcttgtgtgtgAGCGTCCACTGATTGCCTAGCTGCATCAATATCCATCATA
AGGAAGCTCGCGTGGCTGCGTAGGGCGGAAGATGACACAGGGACGcccgctccagctcgaaagCTCGATCCAGCACTGTTTAAACGGAACGACGAGCCTA
AACCCCCGCTGTGACCGAACGGGTTGAAGCCTGAACGACTGAGACGCCGACCAGCGCCCACCACATGGTCTGCAGACGCACTGCGACGCAGTTCCATCAC
ATCGCTCGGCAGCAGTGTACGCTCTCCGCTGCTGATATTAGTGGCAGctgtggaggtggaggcgacATCTTGagtgctgcaggaggtggacACGGGCGTA
TTGAGGATGGCGCCactgctgcgactgcgccGACGAGGGCGCGTCCGCACGTTGGCGCCCTCCAAGTCGCTCATGAGGGGCAGGACAGTCTTTAGCTTGC
GGATGTGTCTTCCTGCACGAGAGACGTACTTAGCCGAGAATAGGAAGTTGGTGTGACTCACATATATATGTGCGTCACACCAGCTGTCGATGTGATTCTG
ATTCCTTCAGTACCGAAGAGATCcccgagctggagctggaacaTGAGTGAGCGCCGAGTGAATGCCGCGCAGGACGCAGTAATCAAAGTGTTAGTGCTGG
GAGATGCAGCCACAGGCAAGACGAGCATTATCAAGCGGTGCGTAGGCTCAGTCGTTGCGGTTagaagtggaggagatgGCTGAATTGTTCTCGTTACTTT
TGCTAGATATGTACATGACGCGTTCTCGGAGCACCACCGCACGACGATTGGTGTAGACTTTGCGCTGAAGGCGGTGACTGTAAACGGCACGACGGTGCGC
TTGCAGTTGTGGGACATCGCTGGCCAGGAGCACTTCCGCGCGCTTAACCGAGTCTACTACAAGGACGCGTTGGGAGCGTTGCTGGTGTATGACATGTCAC
GTCCCGAGACGTTTGACAGCATCCTCAAGGTTCGGAAGGGGAAGGATCGTTGATACTTAAAGGGCATCTGCTGATGTTGTTGGTCAAtgttgcagtggaa
gaaggaaATTGACtccaaggtggagctgcccaaTGGCAAGCATTTGCCGGTCATTTTGTGTGGCAACAAGGTGTGCTTGCACCGCTGTCTCTGTCATTTT
TTTAGAGAGGCTAATCGTATCTGGTTTATGCTGTAGTGTGACctgaaggaggaagtggacaAGGACTTCCTGGATGAGTTTTGCAAGACCAACAACTTTA
CTGGCTGGTTCGACACTTCTGCCAAAGAGAACATCCACATTGACGATGCTGCCAAGGCGCTCGTGACGGGCATCCTGGAGCACCAGGACATCTTTGAGCG
GAAGTcagacgccaagaagcgcaacgacACTTTCCGCCCCACGAGTGCAGCTAACGGCGGCAACGCAAGCCAATCCAGttggtgctgcaacagcttctaA
CCTCTatcatctgcagcagaaatCTTTCCCGCCCCATGCAGCACTGTTTCAGGTCCTGTCGATGCATATCATACTTGGATGGGGACAGCGTTAATCTGAC
ATTGAGAAGTTCCCACTAAAACCCCATTCCTATGGCTTATATTAACGGACTATGATATAGCGCATCTAGTCTGCAAGGCGCCGCTTTTTGTTGCTTATTG
AGCCTTCCGagcgctgcatcttcgtgaAGTGCAAAGGTAGTCGCTGGCTGTTTGAGGTTGAAATGCCACGACGCTCCAAGCTATTGCGCACATCACGGAG
GTTCGTCCGTGCAACGTCaagtttctccagcagctcttgctTGTTCGCCTCGGCTTGCTCTAACTCGTCCTCCAGTTGTatcagctcctgctcctgctca
TGCGGGCTCTGGATATTGACAGAGGCCGTCATATCGTAAATGATCTTCTGCACCCTTGCTTCAGCCTCTGGCTGCTCCGCCTCCAATAAATCCACGGAGC
GGTTCAATTGACGTTCTTCCGTTAGCAAGCAGTACTCGCACAACTTACTTTCGTCCCGAGCTTTGCATTGTGACAGATGCGCGAAGTGGTGCTCCACCGC
CCTGCACATTGGCTGGTTGCACACCTGTAGATCTAAGTGGTGCTGCAGATGATCAAGAATTGACTTGCAGTTAAGCAGGCACCGTCGTGCTTTCGAAGAG
GAGCAAAACGATGCATCCACAATGGCACAGCCCAGGTCCACCACTTCATCAAACTCCCGCTGTGCTGCCTCGCTTTTATCTCCACCTTGCTTGTTCCGTA
GTAGCTGATTGATATAACCTGCGTTGAAGTTCGCGGTCCCGGGTATGCTCTCCTCTTGTCTGTCTTCCGTCTGCTCATCGCTTGCCTCGTCATCTATCAT
ACACAAGCAAACAAAGAAGCATAAAGTTAGTGTACGCAGGGAAAACCAGATCAACTCTCAATTCCAGTTCTCGCGTACCCCCAGCGAAGCCGCTGCCCCC
CTCGTGATCTTCAGAAGGTGCAGACTCTTGAGTCAAATTACTACCAACCTCTGCTGGTTCTCGTTTGATAAATACGTCACTGAAGTGCCACTGGTACTTG
GGGAAGTTAAAAACTGGGGCGCTACATTCTCTGGCAAGTTGATTGAGTCTGTCTGTTTCAGCGCGGAGGGGCTGCTTCCGCTCAGTCCATCTGTTGATAC
TCTGCAAGCAAAAGTTGCGGGTTGCTTCACTGTGCGCACcttgaagtgctcgacgCTGGTCACAAATGAGATAATCCAACGCTGCACATACCCCGATACT
TCGTCGCTGACGAATGCGAATGCAAAACGGACACGCAAACTTCTTGCCATCAGTTGTAGCAGCAGACTCCTTCTCTAAGCACGCGCGCCGGTGTTTGTAA
ATGGTCGAGATCTCACAGCACTTTGGGTCGCCACACACTTCGTCGCGTTTGCAGTGCTCATAGTGCATAAGCGCAGAGCGACACGTTGGCTCTTCACATT
TCCCGATCCGCGCACAAATGAGAGCGTCTTCGATGGCAAGAGCATCTTCGATTCGGTCAGCTAGCATACCAATGAGGACGCGATCGTTTGTGGGAAACCA
GCGAAGCAATTTCTCCAAATCTGCTGGTTTGGACGGGGTTGCTGAGGTCGCGGTCTGTTGTGTGGATAACTGAGCCGCAGGAGTATAAACTTGGGCAACA
GGACTCGACGTTGAGACTGCTACTGGCaatgaagtcgaagctgaagaggGATTTGAACCATGATCTTCCTCGGTCACTGGGGATTTTGTCGTAAGACTCA
GATGAACTTGAGTGGGGACTGTATCGGATGCGACTGGTGAAGTCGACACAGGATGTAGTGCGTTGGTGTCCCATTGCCTGTCACTCGACTCTGCATTGTC
CTCTGCTCTTGAAGCTTCACTCTCTGTAGTTGAAACCGCTTGTGGTGCAGAACTTGAGTTTGCCACGGGGTTTTCACTCGCAGAAATCTCTTTCACTTTT
TCAACTAATTCATCAACCAGTTCAATCATCGCATCCCCACCTTCTGCAGTCTCGTCCACCATTTCAAACTCAAATGactcgtcctccttctcttcttgtg
tGGGTCCATCGTTATCGGCCTCAGCGTTCGCCTCCTGCTTGTCTTCATTCCGTGCAGGCACCGAATTCGTATCCTGTACTTCATTAGTTGAGCTCCTCTC
CACTTGACCCCCAATAAGGACGCCATTTTCAAACGGAACCAAAGCAGCGCTGTTCTGCTGAGTTTCCCAAGCGAAGAAGGTGAGAGTCTCTCCGAAGTGG
CTCGTGAGCTGGTGAGTGCTCGCGAAGCCGCGCGAGTGCCACAACCTAGAGCAGTTAGTGCagagcgtcttctccttgcgcGGGTCGCACGTCGAGCATT
TGAATTGCCAGCGCGCCGAGCGACACCAGCTACAGAGAGCACCGGCGTCCGCAACTGTCGTCATGGGTATTGCAAAATTTACGTTTAGAAAATTGAGACA
AATATCACAGAACAATGTACCAATAGCGATCGCGTGAGCTTTACGCATGACGAAGCCTCGACGAGGCGTCTTGCCCTCGCTGTGGGTGCAAAGGGGGGAT
TCCACACGGCAGGACACCTTGTCTGATCTTGAGGAAGGAAGAACTTCTGCACCCGTAAGCTGAATTAGTCCGGAAGATGATCAAGATGAGTCGTAAACAT
CTATGATTCAGGCCGGAAACTACACGCTTGCATCAGAAAAGCaaaggagaaagaagacTTGGTAATACACGTACGTCACAGTTAGTAAAGACATGAGAAG
GCAAAACAGAAAAGATCAGACAACCAAGGCGAGACCTGACTCAGCACGAAAAACAAACCAAACTGAGATTTAGCTAGCTTGCACTTTCCTGCTGCTTTAC
CGACtgtcttcgttctccttctccccGCTCGCACAACAGCAGCTAAGCAGAAAGCAACGCAGCTAGAAAACGATCTAGCCATCGTGTACGATGTAGCTGG
CCAGCTGGCGCCACGAGGACAGAGCGAAGATCTCCTACTCCTAGCGTGCTCTAAGTGGCGTACTTGGCGGTCCATTCGCGGGCAGTGGCGTCGTGGCGCG
CGCGGTCTGTTCTATAAATTTGCGCGATCTCAGGCACCAGCGGGTCGTCCGGGTTGGCGTCCGTGAGCAGCGAGCAgatcgacagcagcaccttgGAGAT
GGTCAGCGCGGGGCTCCACTGGTCCTTCAGAATGTCCAGGCAGATGCCGCCGTTGGCGTTGATGTTGCAGTGGTAGATGCGCGTCGTGAAGTTCACCTTA
GGCGGCTTGAACGGGTAGTCGGCCGGGAAGTAGATGTTCAGGAAGTACACTCCGCCGGCGTACGGGCTGTCCTCGGGGCCCATGATAGTCGCCTGCCAGT
GGAACAAGTCGTCGCCCACGGGGCCGGCGCTGCAGTTAGCGGGCGGGTCGCGGCCCAGGTCCTGTAGCTCTTTGTTGATCCGCTTCAGAGCCATGTTTAG
TTCTGGTCCTTCTCCTCTCTActccgcttctgctgcttcctgctaCGAAAGGATAATGACAGCGAAGGCCAAAAGGGGAGCGGAGGGGGCGAGATCCCCT
CATATAGCAACTCGGGTGACAAATTACTTTGATATTGTAAGAAGAGTTGCTCAAAAGAGGTCTTCTGGAAGTTTTTCTTCGGTTGCGGAGAACGGGTCTG
GCGGGTCGAAGCTCTCGGACTTAATCGAGAGATACCCTAACATCTGACCCAAAGATAGTGATTTGCTAAAATTGGCGAAACGAAGCTTATGGATTGGTAA
AAATTAGATACACCCTCCCTCGGCGGATTGCTGCAAGTGAGCGTGGTGATCTTTCAGCGCTATTGCAGTAGTGAATGCTGGTTGCTTGGTTAAGGCTCAG
AAGGTAGCACTTCTCGCGGAGTAAGCAGACACAGCTGGTCGGGTCTATGAAGTACAGTACCAGCCGTAGCGTATCGATTCTTACAGGCTGCTATAAGCAA
CAATTGGTTCGTCGAACGAGGTCATTATTCAGAATTGCAGGGACAGACAGCAAGACGACGCAAAAATTACACTTCAACTGCCTCCATTGCTGTATTTGAC
AAGCATCGTAGCTGAGGGCGGTGGTGACGCCAATGGCTGCTTTGCGCGAGGTATCATTGGCGATCGCACAACGGCCGGGGGACAGCCTCAGCACCGCCGT
TGCTCCGAAAGAGACAGGAGCCGACTGCTTGCTCGTAGCGTCAAGTTGCCGTCGCTACGTTGGCAAGTGACTGCCGCAGTCCAGATAAGTCTCGCTACGG
TCCGTAGCCTACAGATATGTACACCTCGACGCCCAACTGTCGCGCTTCAACGTGATCCCGTTGGCGTTGACCACGGAGTTGACCATCTGTGCCTCATGCC
GCTACGGTAATGACATGTAATGGCTCTGAAAAGTGATTCGGCCAGCATAACACGACAGGCGGCAGCAATCCTGTTGGCTTTTGCCGAGATTTTTTCATGT
AGTTGATCTCCAGAACCGCCACATTGCGCCGGGCTGCCGCGGAAAGCTCAGCGCCGCCATTGGCACCGACGCCGCAAGCCGCAAACCTCTTTTTTcatgg
agctgttggctCGAACACGACTTTACCCGTACTGGTCGTCGCGCCGTGAGTAATTTTCACATACAGAGGTGGAAACGTATTACTTCAGTTTTTCTATCAA
CACACATTTGCACATTTAAAGCATTTATTTTATACTATACCTCTTATACAAAGTTTACGACTCGATATTAATATAAGCAGGTGCGGCACCGCCTCATGCT
TTGTAGTCGAAACTGGCTGGATTGAGCCTGCAGACCGTCGCCGTCactcttgctcttgcgcCTTCACCGCGTAGTCGTTCATCCTCTTGTCTTCTTCtac
acgcagcagccatGGGCGATCGGTACCGCAGCGCTCAGTCCCCgcgcaacagcagcggcggcgtgACGGACGAGCGATTCAGTAAGCTCGTGAGCGAGAC
GAGCAAGGGCATCTCGACCTTCAACCAGCTCACGCGCAGCATCGCGCAGAAGATGTCGCTGTTCGGCACGCCGCAGGACTCGCGTGCCAACCACAACCAg
atcaaggagctcacggAGAAAGGGAACAAActcgtggccaagatcaacCGTCGTCTACAGGAGCTCAACCGTGGGGCCAagggagctgctggccgtaCGA
GACGCACACAAGTGAATAAACTCTCGGCGGACTTTAAGAACCAGGTGCGCGTGTTCGAGGAGACGTGCGAGCGGCTGCTCGAGTCCGAGCGACAGTCGGT
GGAGTTTATTCGTCGTTCCTCGCAGAGTTTCAAGGGTGGCAACGGCCGACAGACACGCGGTGGAGCCGAGTTCACCAACTACAGTGAGGACCAGATCTAC
GCGCAGGCTAATGTGGTCATttacgacgaagacggtgCGTTGATTGATGCTACCGTTGTGAACTTAAGGATTCTGACTATTGTTTTGGGGGCTTTACAGA
CCTGCAGCGGAGAGAGGATGATATCATTCAGATTAACCACCAGCTGCGCGAGGTAAACGCTGCCTTCGAGGAAATCGATGGACTTGTGCAAGACCAGGGA
GAGATGGTGGTCGAGATCGTGGACAACACAGAGACAGCCAAGGATAACGTGGAGAAGGCACTCGAGCAGGTGAAGCAGGCAGACGAGCGCAGGAAGTGTT
GCGCGtgctcgaagatgaagctcatTTGCATCGCCATTTTCGCGCTGCTTATCTTTATCGCCCTCATGGGTATCATTTTCGCTGCCAAGTGATCAGTTGC
TGTTGGGGTTAGGAGGCTCGTCTTCGTGGCATTGTCTTGTGAATATAGTGACGCTGCTATGGAAATGACGAGGACTCGGTTTATTTCTTAAAGAATGGGT
TGTACAACTTTGCGGTGATGGTACATTAGCTGTAGATCTTTTGATCAAGTGAAAAAGCACGTCACTAtatactaccggtacatgcacTAAACGCTACCGT
TCCTCAAGTCGAAGACGAGCTCCAATTTCAGTGATCATGTGCGAGCCTCGACGTGTGTCAAGGTTTCTTTTCGATCGCGAGCTTCGGAAAAAGTTATCGG
CCACAGACTTGAGCATGTTTCCCACTGATCCACTGCTatggcgtcggcgtcgtgaGTTTGCTTCGGAGGGTGCTGTAGTTTCCGCAACGCGTTGACGCGA
AAGGCGTTGGGTTCGTGATGCCGCCCCCGAAGAGGAGCTAGCGCCACCGTCTACTTGCTTGGCACTAGAACTTCTGCCTGCGAGATGTGGCCTTGAATCG
ACGGAGAACATGGCCGAGAAGGGAACCGCAGTGTCACGCTCGGACGAGTCGAAACAAACTGCACAAACTCGCTCTTTCTCgtccacagcttcgactacGC
CGTTGAAGTATCTTGCTGTCCCATGCACACGGCCCATGACCGACTCCCCGACGGTGAAACTCACGGGGGAGAGCTCGAACCCCATCGCGTCAATGCTGTA
GTTGGTTAACCGTTGTGTATGGTACAGCGCGGCCATATCATCCAGACTAGTGATCTTATCGGGCGGCATATGAGCTTTCAGCTCGCCGTAGTCGAATACC
AGCGTGTATAGCGCGGTTTGCACTGAAGCTACGGCGATGGCATGAGCTGTAGGAGACGATAAAGATGCTGGTCCATTGGTGGGGTCTTGAGACAATTTGG
CAATGATTTTGGCTGAACAGTAGCGCCCGAAGCGTGAACTCCAAGCAAGCACGTAGTCTCCGACGGCATACACTGGTGTGTATTGCGCTCGGCTCGAGCT
CTGATGCTCCACGCTGTCAATGATCATTTGCGACGGGAACACCTCGAAAGCGATAGTACCATCCGAAAAACGGAGATCGCAAGCGGAAGAATGGTGCGTT
TTGATCACAATGCAGCTTTCAACGGCCGCCTTGCGCGGGTGATCAGCCTTGACCTGGTATCCTTCCTCCAGTACTGGAAGAGTCtcttttcctcctccgt
tTGCAGCCGCTGAAGCCTGCATTAGGACGGCATTCTTGAGAGACCGCACGTCTTGATCTGCAGGTACGCGCAAGCGCTTGCGTTTAAAGATAAGCTGTGG
AGGGATCTCATACCCAGTGGAACCATCAGCAAagtcaactgctgcagttttgtTCGAGTAAACGCCATTGAGAAGCCCAAGCTTCTCATCCTCGCAGGTG
CTATCGAAGTCGCCATTTCCGGCAGAACACTTGACATAAATCTGGTCTCCAATGTACACTTTGACCTTGTTACTGCACACGAGGAATTGGTCTTCCGTGA
TAGTCACCGCagttctcttcttctctaGCAGGGGACTTATCTTGTCCACTGGAACGTTCACTAGTCGAATACGGTTCGCAAGCAGCACATGAAAGCGCGA
CTGGTACTCCCGCTCAAGAGTAATGAGTCCACGACCAGAGAAGCGACTACCTGGATACAACGACACCTGGACTCTTTGGCCAGCAAAGAAGACGCATTGT
GTTCGCTCGAGGTCAGTCAactgctgttccagttcattCACAGACGGCAAGAAGTCCACCTTGTCTTGAGGCACCATCTGCACTGAAATACCGTGTTCGT
CTTCAGTCACGACGGCGTAGCTGCCATCTTCGACGCGTTTTGAGACTGTACCGTAAGCACGAATACCTTCAGGGGATCGTTCGTAGACAACTCGAAGACT
ATCACAATCTCCTCGCTTTGGGGAGCACGCATTGCATCGAGTGGATCGCATCATATTCAACTTCGCCTCCATGAGCCGGATATGCTCAGCCAAAGCGAGT
TCTTCAGTGGGTTTGGACGGTTGAACCTTTTTGGTTCCACGTAGGAAGTACTCAGTGATAACCTGCTTGAGGCTTTTTGGGGTCGGTATGATCTGCTTCA
TGCCTTTGTGTGTCACTGATAGGCGGTCGACCTGGGAAACAGATGAAATGCTTGATCGCCGCCCAGTTCCCCGCTGCGGCCGAGTAGCTTTACCCATCCC
GAAGGTCTGCGTCATTTGTTGCCAAGGTGTCATCGACATATCGTCTTCGCTGGATTCATCCGAGTCACTAACTTGAGTTGAGTCGTCCTCGTAGCCCACC
CCACACTCCAGTCGTTTCATTGTCAGGGTTTCATCATCTAAGAGAAGGCGCCAAGTCTCATTCTCCGCGAGTGTGGCACCGCAAGAAAGAAAACCGACCT
CGTAAGCGACGCCACTGTCGTCAAAGCTCAGTACCATTTCTCTCGGTGGTGTCACGGAGAAGTCTACCATTACGTGCTGTAAGGGTGGTAGTTGCATCTC
CGGTGCCACTGAAATGGCTAAGCAATCTTCGCTCTCCTCACCTGACTTTTGCTGCGATTTCCTTCGTGACTTTGAGTTGTTGGCATTCTCTGCTTCCCCT
CTACTGAAGCTGTCGCGACGCAACGATCCGCTGTCCGCCCTCTGTGAAGAATTGTTCTGTTGAGTTGAAGCGTTTTCTCGCAGCATAATATCCTCCCGAC
GAACACGATAATCTAATGTCCCGTCATCAAATACGACCATGAACATCCCTGCGCCGAGGTATGTGGCAATATTACCCGAGTAGAAGtacggcgtcttctt
gtaTCGTCCAAAAATGCGTTGCCCGTAGGTCCATTGACTGTGTAGTGGTGCGAATCGAGAAATGGGCGTATGAGGTtctggttctgcagctgacgacgat
ggaATGTCAGGGATATCGGAGCCGGGTTTATAGTTGCTTTCAGTGCGAAGATTATCATCAAGTTGGCGATCCAGAGGCTGCTTAGCAATTTGATCCGTTG
ATTCCCTGGTATCTACCACATCAAGGGACAGTGCCACAGCTACCATCGGCTTGATAACGGAGGAATCCCTCCTGCTCGTGATTGTTCCATCTCCATTAAC
CTGTAATCGAGTACTCAGCTGCCGAATTGGTAAAACTTGGATCGCCCCCTTTGGAGAAGCCTCCGCTCTGACAGGAAGCGCGCCGTCATCATGTACTTTG
ATGCGTTCGCTAAGCTGTCGAATGGGCGATAGCGGAACAATTCTCGGAGGTAATGCAGGCTTGAGAGCTGGTATCTCATTGCTGTGAACATCATTCGTCT
CCTCGACTGGAGTAGAAGGCCAACTTTTGCGCGGTACTACAGCCAGGATCTCTTGTGtgctagtacatgtagatatCCCGCCATCGTGAATTTGGAGAAG
CCCGCTACGTTTGGCAGCTGATGATGGTCTACTGGACCCACTGGCATATCTCGACGGCGACTCCAGTTTGTTTGTGAACGACCCGACGCCTTGAGGTTGG
CGAGCGCTAAACTGCTGCGAGGGCAGTGCTGGGTTGCTCATTCTGGAAGTCATCGTTGAGAGCTCATCGTTGCTTATGTCATTATCGTGTGCCTGAAAGC
CGCCGCTGAGCCGAGCTGGGGGTGTCCTGTTAGGTGTGTCCCTAGGGGAAACCTCCCGCGGAATATTCGGTTCGGTTGAGACCAGATCTTCGTGAATCAA
AAGGTGACCCGTGGACTTCAAGGCAGAAGATGGTCTGGTTGCTGTGGTCAGCTTTGAGGCCTCCGCTCGGAATTCTTGTATGCCTTCCTCGTGGATATGA
AAGCGCCCACTGGGACGTCTTGACTGCGTTCTTGCCTGTCTAGAATCGACGGCTCGCATGGCGTCAATT