Description :
From Genome Similarity Track
Location :
Scaffold_6:281239- 283180
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02422CorA Metal Ion Transporter (MIT) Family
Sappa_CBS223.65SPRG_02423protein-L-isoaspartate O-methyltransferase

Sequence
1941 bases(100 bases per row)
TCTGCAAGTACGGTTGCCGCCGTGATTTCTTGGTGTCGACACGAGAGCGTAGGTTCCTCGCCGACGACTTTACCAAGATGGCGCCGATCGTCAACAGCTC
GCTCGAGCGACTCGCGAGCGCCCAAATGTCGTCCGGCGAGCTCGAGACGCTGCGAACGCTCAAGAACGCGATGAACGAATTCGAGTCCCAGGTGCCACGG
CTAAGGATTGCACGTGGGATCTGAACGACGGGGTGTGCAAAGGTCAACGGGCTTCGCCGCGTGCTCATGGAGGTGCTGGACAATGAAGTCGACTTGCACT
TGATGTACTTGACCCAAGTACGTCCATTCCTCTCGACTCTCATCGTCAGCGCGCAACCGTAGTTGTACCAAAACCCACGGATGCTCAACGAGCTCTGGAC
GTTTGACGCGGAAGAAGCCGAGTCGCTCCTCGAAGTGTACCTCCAAGTACGCTCATTTCTCAATGACATTATGCTGAGCGCAGACGGCAGGACATTCACT
CAACCAAGACCAAGGTCGCGCTCATCCTGCATCGGATCCAAAACACAGAGAGCGTCGTCATGCTCAAGATGGACGCGGTGCGCAACTACCTCCTCACCGC
CGACATGATCTTCACGCTCATCATGGTCTGCATGACCTTTGGCATGTTTGTCACCGCCGCCTTTGGCATGAACCTCACGTCCGGCCTCGAAGCGACGCCC
GGCGCGTTTCTCACCGTCCTCGTCTCCACGATCGGCTTCTCGGCCGCGACGATCTTCGCCGGCATCGCGTTCTTCAAGAGCCGAGGAGTCATCATCTAAA
ACCAATTCCGTATTCATTCACCAATCGACTCCATACAGGCAAGACACTATTCAAGACCACACTACGGAGTTGGACGGTTCACTCCTCCGCGTCCGTCGAC
TCGTCATCCGACACCATTGCATCGTCCTCATCGTCCGTGCTCGGCGGTGACGCCTGCGCTTGCACTCTATCGTACACCGCCATGTGAGCCTACCAACAAC
CGGCAACCCAGACGTCGTACTGCGCCAAAAGGGCTTGGATCTGGTTTTGCTGGCGCCACATGACCAGTCGGTACTGGTCGCGCTCGGCCTCCGCCTTCGC
AGCGCGTGTTTCGGCCTCTTCCCGTGCTGAAGTCTCCACTATGACCCCTTGTTGGTGAGCTTTTTCTTCGCCACGACGTACGCTCGAGGAGGAATCGCAG
CTTCTCTGTCGTGCTACGCTCCGGGGCAAACCACGTCTGCGGCAGCATCCTACGACTCGCGTGAGCGTTTCCCGCGCGCCCACGACCGTACTCGAAGAGC
CGCAGCCACACCATCGCGGGGAGTCGATCTTGCGCCGGATACAGCGCCGCAACCGCCTGGCGAAAGGCCCCGGGGTACTTGGCGTGCTGCTGCAGTGTCC
ACACTGGTGTCGACAGCTGTCAAGCGTCGAGTGCGATACCTCCGCACGTACCTTGCGGTGGAAAGTAGCAAACTTTGGCAGACGTGTTGTTGTCGTCCCG
CAGCGGCGCAAAGTGCACGCCAGTCAAGACCATCTTGGTGCACGAGCCGTCTTCGCGCGACCGGATCTTGAGCAGCTTGTCGCCAAACGGACCCTACGCC
TCGAGCTCTTAGACTGCATCAAGGCCCCAATGCACGTACGATTGCAATGCCCATCGGCTTGAGGAGGGCGTGGATCGTCGTGATGAGGCTCTCGGAAGCG
CCCGCGCCAACGTAGATGCTGTGCGAGAGGTTCATACGTGTCCTGTGGGCAAAAACGTACCGGTCGTACTTGACGTTGTTGCCGCACTCCATGGTGTAGA
CGCTACCTTGCACGACGTGGGGCACGCTAAAGTCGTCGCTCGACTCTTCCAGCATGTCCGTCTCGTCGCGATTATTGTTGTTGTTGTCGTTGTCGTCGTC
GTCATCATCGGCGGTTTGCATGACTGCATCGTGCGAAGCCG