Description :
From Genome Similarity Track
Location :
Scaffold_39:281231- 287892
Transcript NameFunction/comments
Phyca_LT15349564neutral zinc metallopeptidase, Zn-binding site
Phyca_LT1534570850neutral zinc metallopeptidase, Zn-binding site
Phyca_LT1534550885cell division protease ftsH putative
Phyca_LT1534570854CREG-like protein
Phyca_LT1534119659aldose 1-epimerase, putative

Sequence
6661 bases(100 bases per row)
aagagcgttgcgtccaagttcaaagccatgttggagcgtcagtacgcggcgtggaaccactggttgatcggctacgactgctggccgtacaacgagatca
aggtcaacatggtgggcttcgctgtcaaggatgtttctctgcttgactggacagacgattcgctcggtacgattaccgtcggggacctggactcggacgg
tgttccgcagtgtgcccagagctgctaccggttttacgacaacggtgctggctcgtggtcggacaccagctcttgcaagggagagccgttcgacatttca
ttgtggccgaagcagggcctggagggcggatttggctacgactggggccaggaggtcaacctcgagaatatgctgtcgaccatcgatgaggaccaactgg
tcattgtggcgcacgaaatcggccacgggttcggcctcccggacttctacgaggacgcagacaagcccaacgctaagtggcctaactgcatcatgatggc
cggcagctccatgtccgtgacggacagtgacggctggatgcttcgtcgtgtcctggagcacttgaagcctcgctacaagttctaaacgtagtcctcatgg
agtcgtggtcgtacctggctacagtgtagactctacactgtttgttttgctcgcattcggtacgggcaccttggttaattgttgtaataatgtaagtgaa
tgttatggattaagctgcagtgagtattttgtggtgaattcgaacaatgatactacatgtatgaaccagagggtccttcgacttctaattgctggtgcac
agctagtgtccagtattcaacgctggaccaaagctcgtcgccgtggacaccgaggacttgtattaataatcacatcatactgcatgatcgcatttgctat
agcgtaccgaccctgactcactttgaaattcgagaaaaacacatgtacacatagcaaatcgttcgtcttgactactgtaaagctgtacttgaagtacatg
ttctcaaactgtaagtttatgtgtaatcccggcctacgcgtcatccgctcaagccgcgtctctaaaaaaacgaaattaatagcttatgtcaaccgtcaca
gcagtatggatgccatccataggatggacgacgtggttgacgagcagtacagcagtatagtgtcaacacacgttagtttcaaactacgtgtgttgacatt
aatttttgtcgtagcattcccaccttgtcgcactgaaagttccagtctggaacggcacacgaaatcgcaactgcaattccgagtatcgtatccggtgacc
ccatctgaatgaaacgatagtaaaggcgggcaggattggtctgttcagactgaagaagacttggttatcgcctctgtgttacatacaagcattcgccagc
ctttatcgtgttttcgttgagcgaacagcgatagaggggactgtaggtaaattaaaaatgttgatggggttaatctgcctacccattgttatatttgagc
cgttcattgctagaatcgccaccgatggcgccaagtcgacttcctcgcacctccgcagtgctgctagcggccaccttggtcgccgcatcttcggccatcg
agtttggcggccagaacgacgtcacccagaccgacttcgctcaaaccccaggaacagtagcccccgcaggcgaaacgccaacgacgaataccggaactgg
agcgagcggctttgggaatttcgataacccagcgcagtggacacccccgtcgtcaaaccaggtgcctaccactgcccccaccgcttctagtgggagtggt
tggtctcagccttcaacgcccacggtttattctgccgatagcggtcaggcaagtggaagtggcccgagtgaaacgtggacgcagcctaccacgacgcagt
ctccttcgggttggacaccaccgtcaggcggtagcggctgggcgtcgagtggccaaggaagcgttacgacggatcaaggatggtctcagcaaacagacac
gtcgtctaatgctgccccgccctcaacgggggactccgggtcgacgccaccggcaggaagcagtggctggatgcagccgagcggaagtggaaaccagggc
tggacatcgagtggccaagggagcggtacgacggaccaggggtctcagcaaacagacacgtcgaatgctgcgccgccctcaaccggctccggtgaatacg
aagaaactttgagtgtggactgcagcagttcgagtgaaggggaatcgccgggatatgacatgagtctggagtgcagtggctcagacgacgaaggcagtga
aacacccggctatgatatgagtcttgagtgcagcggctcggacgaagagccccctgcgaccggcggttcttccaacgacaccccaatgacgccccccgcg
accggcggttcttccaatgacaccccaatgacaccacccgcgaccggcggttcttccaaccaagaatcgtcctcagactcggccactccacctccgagca
tcgatgaatcaaccccgacgacgtcgtctacgtctagtggaactgacgatcaagaccagtctcagacgcctaccacggaatcttcctccaacacgcctcc
gtctcccgagtcttcgtccaacactgaatcatcttcagacacagcccagcaggggggatctgacgcaactcaaactggatcggacgccacacaaacggac
cctagcaccagcaccggtgaccacgcctcgttcggcaaggtgacgtcgaaatccggcgaatgtgtcattggagacccggagaagtacatcagtactaagg
acgtcaactggatcttcgagaaccggatgggagtgaaccagaccaacaacaagaactggatcttcgaccacatcgtggccaacaagggcaccctcaacta
ctgcgtgcgatgggatagtactcagaagctttccaagacggtggcatccaagttccaggcgatgcttgagcgccagtacgcaatgtggaaccggtggctc
atcggctatggttgctggccgtacaaagagattaaggtcaatatggttggctttgcggtcaaagaagcttctctgcttgactggaaggacgactctctcg
gaacgatttacgccggcgacttggatgctgaaggagtccctcaatgtcctcaaacgtgctacaaattcttcgacaacggtcttaaggcgtggacggacac
gagcggatgcaagggagagccattcgatctctcactctggccgaaacaaggactggaaggcggattcggctacgattggggccaagaagtcaacctggac
aacatgttgcagacgatcgatcaggaggtgctccatattgttgctcacgagatcggccacggcttcggccttccggatttctactcggaagcggaccaac
cgagcaaggacatggctcctgctatcatgatggctggtagttctatgaaggtcactgatagtgatggctggatgctgcgtcgcgcatacgagagcatcag
agaccgttacagcttcaagtagattctgctttaccagtagaattcatgtttcgttttgttgctcgcatcaggaacgagcaagtagagtttaaggaggaat
tccaaccattcgatgttctctcaaatcttatcaccgctgagtttattcctcctccatcgtgaattcgaatgaagacccggcgatgctgcgtgtctgcgac
tcaaacgcgcggttcatggccagttcaaagtgctcatgtttgatactcgtgtcaccgtggcgcacagccagcaacgctgcctcgttcacgagactcgcca
gctgggctccggatcgctgtcccaattggccgcactcttccgcgacaaccgacagatccacttcgctgtcgagacgcacgttgcggcaatgcacctctag
aatctctcgacggccctttgtatcaggaagacccacgtacacatgtcgatcgaagcgaccagggcgacacagtgcaggatccagaacctctgggcgattc
gtagcggcaatcacgatcaccccgttgacgttgccttcaaacccgtccatttccgtcaataactggttcagtgtctgctcccgttcgtcgttcgagttga
atcccccacgggcttttgcaagtgcatcgatctcgtcgataaagatgatgcactgcgggtactgcgacgcctgcgtgaagagatctcgcactcgagcagc
acctcgacccaccagcatctcgacaaagtccgatgccgagcaaaacaggaaggccacaccagcctccgaagccacagctcgagccaacaacgtcttccct
gtccctgacggaccacagagcagcacacccttcgggactttagctccaatggcctgatacctggccgggtgcctcaaaaagtccacaacttcttccaact
ccttcctggcaccgtcaattcccgccacgtcatcgaacgagatccgctgtgtctgttgctgtttgcgcaccttcttggtgccatccttgcctactgcccc
agcgtcggtgccgaacatcccacgcatcatcttgtacgtcagtcctaagtacaggaatggcatcaaggccagagcgacaggcatcaacttgctggctgtg
gacggtgctacagagccaaattctaccccagaacgcacgaggatgtcgaggatataggcattctctgtccttgggggcaccagcactctagatacacaga
agtttgtttaattttataggtcgaatctcataattaatataccgaagaattgaagaaattcagtgcaccaagccttacctgtatgactccacaccattcg
ccgcctgtacaatgcagtggtcacccgctagcagtacttttccgacgcggtgatctctcaggtcacttaagaagccactgaacagtctccaggacggcac
agcggacgatccagacgtcgttagggcgcgaaacttggccaacatggacgcaatgaacatacggagcttctgcgtgcccttgccggcaagtagaagcacg
cagagcgccgtcaggaagcgccgcgcactaggcactcgcatgatcaagtcgaaaatggaggttgagtcaaacaagtacaaagacgtgaccatacataatt
gaaaaaagtaaaaatatacgaaacagaacaatatatttgatgatagtttttctaaaccacgttctaaaatattatctagaaccacaggtttagtatttga
gcataagtttcttactttgactgagtatatgtaaatcacatgatgtaatacagaattcatttccttagccataaagtgatttgacttacttgaagatcaa
gaaatcttcgcacgataacaaccagctgacgttgccagaactcatagcttgactttgtagtagtcactgacagcaatatgcttcgctgcaccgtagaagt
ccaagaatacgatgtgctcgatctccaacacgtagaaggcgaagccgtgattcttcggccagtgcttcatctgcgggtgcctgtagtacagtcaaacggt
gagctttcgttcatctaaccagcctcaacagcttcttacttggagaaaaccacacgttcagcatagccgcgctggttttccttggcttgcacaactttcc
ctgtcatggagaggcgccaacacgtcgggtcttcggcgtccatatagcaggcatttggtcccccttgagctttcgacaacgccatggtggcattcgggtt
tgcttttaagtccattgctgtacacaaaaagaaactgcattagtctctatatcaatcaccagtagaatatcccacctgtgaagtcctcgacagagagata
gaagaagagtgttcctgtagcgtcctctttggcaaaccccacgccatctaaatgcactagagtttaatctactagtagatttaaaaaaatgtgacgtggg
tcttctaaccactataagatgccacattagcaaatgctgagcctggaaacgtgacggacgtagtggccaacatcccccacacattctcgtgcacgagcat
acgagcgtgtttggcatgaagtttggcgagtgggccactatcttcctggtcggtgatgagcgacgtcgttgcagcactgtagacttcactaccaggagtt
ggcgacgcggccatcagcagggaaaacagcacgaggaagaaggtcatggcggagatagcggctttccgaattaaagccagacgatgattggatgaaggaa
tcaagtacctattagaatgtaagtcctctataaataaattaacagtttttaagtatttctgtttatcaagggttttaagagtttttaaatacaatacctt
taaaaccgcatatttgattttgaagtaaaatacctatttgatcgtcaacttcaacaacaaagaatgatggtctcaagcgtcaacttcaacaacaaagaat
gatggtctctaagcttccgctacagcgatggcctggtgaagagtgtatgtttggccggcagggagcgtttgcttctcggagacacggccaggctcgacgg
cgagcatgttgatgtattcctctgccccgaagtccttgaatgtctttgagcgctcgacccacgggttccagatcacagcgtcggtgtcctgcttcgtctc
agccgattccgtgccaatgaagcccgacttctcaatcgttacagtgcggtcggcggcgttc