Description :
From Genome Similarity Track
Location :
Scaffold_123:28123- 33159
Sequence
5036 bases(100 bases per row)
TGATCTTTGTTGAGGTTGCTGTTTACGACTGAAAATGTATCAGGGTATCGCGTGCCATATCTCAAAATTGTAGCCTTATTTTCAATGCGAAAACTTACGT
TGAGTGCATCAATATGCAGATTCATAATAATGATTGAATCAACCGCTACCAGTAAATCTTACACACGTAACTACAGCTGGATATTCCGTACTACGATTTT
TAGCTTGTGTGATGTTGCTACTGTAGGGTGTTTCACACGGCGCAAAACGATTCAGATACTGTGCTGATGACCTGACTATGGACGCGCTGCTTCACACGAG
CACGACTTATTTATGTTGATGTAGGAAACTTTAGATAATGTTGAGACCATGTGTGGGGCTGTAGCGGAGCGACACAGCTCCTTAAGCCAGAGGAAGACTT
AGTGCTCAAAGATCGATATTAGTTCTAAAGAACCCCACCAGACTGACGTTTACCCAAACGGCAATCGAACGTTGTTTTTCAACGAGGTCAGTGCGCTTTC
GATTAACCTCACGGTTTACGCAAAGCTTCAGCACAATGTCCTCATCGCCTAACGATTCAAAGGCTCCTTGCGCATACCTCGGGATGGAGGAGTCAGTGGA
CTATGGTAGCGACCCAGTCTCGCGGGTGATGCAAGGACAATGTCTGATACACCCATGTCTGAGGTACATCCTCCAACTCATTTAGGTCCGTTCGCTGACC
GTGATGAGGTAATCTTTACCAACCCTTTTGATGAGCAACAGGAGTTGGCTGTTCAACGAGAAGAAAGTGCTCGGCGCCATGCGCAAATGGTCACGACCCT
TGAAACCAGCGTGACTGTATGTTCACCCCACTCAGTGTGGAGGAACATCTATGTCAAACGAATGGCCAAACGTTGGCAACGTGGACCATTGGTCCTGGAA
CTACTCCTCCCGAGGAAGTGGCAAGTGGCCAGGCACTTCGTGAGAGGTACCTGGAGCCATATCTGACAACGCGAAGTCAGTACAAGGCACGCCTTGAGAT
GCAAGCACGTGGTCCACCGGTTCACCCGATTAAGTGTATACCCATTCTCTTTTTCGCAGGCGAAACAACGGACGAAGAAGACGACGCTTTCGTTCTCTGG
GTGCACCGCACTCGTCACCTCAGCATTATGTACGCTCTGAGAGCTAGTGCCAATCTGGCCGATGTGCGGCTTGAACGCAAGCTTCGGTATGATTATGACA
AGCTAAAGGCCAGAGGTCAATTGCGCAATCGCACGCGCTATGCTTCGGCTACTACGGTAGCCGCGAGTGCTAGTCAGACTGTGACCACGAACCCGCCAAT
TCACACCACTAGTGGTGAGAAACGGGCTCGGTCTTGAGATGACCCTGGCCACGATGTTCAAAAACATCCAAGGCGTATGGGCAATCTTGCCGAAGGGGTA
TCTCGTACTCCCATGAGTTTTCCGACTCAGGGTACCATCGCCACTTTACCAGATACTGGTATTGGCCATGAAGACGACGTCGTTTCAGTAGTCTCTTGAC
ATGAAACTGACGATTCCCATGCTCATCGAGAAGCGTCGGGGGTGGCCGGTGTACCTGTGGCGGACCACTAAAAATTGGTTCTCGAAGTGAAGGGTCTCCA
AGAGACCTTGGGTAAGACTCAGATATACTGGATGCGATGAAAAGCCGCCTTCAGGAGATGAAGCGTGCTCAAACTCGAAGCGAGGCTCAGTTGGACTTTC
TGATTCGCTTACAGCAATCCGGAGCACAGCCCTCGTCGTCGGCGCAAACGCCTCCAAGTTCACATGGGAAAGATCCCGGTATGGCTTAAGTAAGCCTACG
TAGAACACTGGGTGTGTACGCAATTTGCGTGGAAGGCTTAGCGTATACGCAAGTCCCTTCTTGGTAGTGACCGTGAATGGTCCAATAAAGCGTGGACGCA
ACTTTGTCTTAAACACAGCGGACACTACATTTGTAGGTAGGTTTTTAGCATTGAGTAATACTTGGTCTCCGACCTTATAACATTCAATACAACCTCTGTT
TTTAGCACCTGCTTGTTGTTTTTGTTGATCTTGGCTTTCAACCATTGCGTCACGAATATGTCTTAAGACATTCAATCGCGTTGCAAGAAACACGCTTACC
TGTTTTTGAACATTAGCAGGGCTGATATCAGCAAGCCGATCGGCAACCTCTCCCCCACCAAGCCCTGAACCACATAGTGGCAGCGTTAACGGAACGCGAG
GGTGGGTGAGACCGTTTACGTAGAACGGAGTATAGCCTGTAGAGGCATGAACAGCGTTGTCAAACGCATACTCAACAACAAGGAGCATGGATCTCCAACG
CTTAGGCATATCAGCGCAAATACTGCGCAAAATGTCATTAATTAAGCGATTAACACGCTCAGTTTGACCATCTGTCTGCGGATGATCCGCTGGGTACATG
TCCAAACAGGTGCCGAGCACCTTGAAGATGGACTTCCAAAAATTCCCAGTGAAGCGGGGATCTCTATCAGAGACAATTGCCACTGGCAAACCATGTTGTC
GAAACACACGAACAATGAACAGAAAAGCTGTACTTTCGGCATCAATAGATTCCGGCACTGCCGCTAGATGAGCCATCTTGCTCAATCGGTCAACAAAGAC
CACAATGCCAGTGTTGCCTTCCGAATCTTTCGGTAGGCCAAACACAAAGCCCATACTCATGGAATCCCAACACCCAGTGGGTACAGGCAGACTAGCCAGC
GGCTCCGCCGCATGTGCTGAGGGTTTCACCCGTTGACATGTTTCACACGTACGCACATAGTTGCTCACCCACTTGTATAGTTTGGGCCACCAATAGGCCT
GTCTCACTGAGCTATAGGTCTTCTCACGACCGAGCTGACCACTTAAAGCGGTATCATGTGCCTCATAGAGTATTCTATACTTCGACTTCTCATCATGAGA
GACAGCAATACGAGGGTTATCCTCAATATCGGTGCGATAACACAACAGGCCATTATCGATAGATTATCGATGTAGCCTCGCACGTAAACGTGCCGACATT
TCTGTGTCCTAGTCTTTAAACTCCTCGCTCCCAAGCGCAAATAGCAAAGCTACACCCTCGTTCATCCTTGNNNNNNNNNNCATTGCGTCACGCACATGTC
TTAAGAAAATTTAATCGCGTTGCGAGAAACTCTCCTACCCTGTTTTTGAACAGTAGCAGGGCTGATATCAGCAAGCCGATCGACAACCTCTCCCCCCACC
AAGCCTTGAACCACATAGTGGCAGCGTTAACGGAACTCGAGGGTGAGTGAGACCGTTTACGTGGAACGGAGTATAGCCTGTGAAGGCATGAACAGCGTTG
CCCAACGCATACTCAACAACAAGGAGCATGGATCTCCAACGCTTAGGCATATCAGCGCAAATACTGCGCGAAATTTCATTAATTAAGCGATTAACACGCT
CAGTTTGACCATCTGTCTGCGGATGATCCGCTGTGTACATGTCCAAACAGGTGCCGAGCACCTTGAAGATGGACTTCCAAAAATTCCCAGTGAAGCGGGG
ATCTCTATCAGAGACAATTGCCACTGGCAAACCATGTTGTCGAAACACACGAACAATGAACAGAAAAGCTGTACTTTCGGCATCAATAGATTCCGGCACT
GCCGCTAGATGAGCCATCTTGCTCAATCGGTCAACAAAGACCACAATGCCAGTGTTGCCTTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCATACTCA
TGGAATCCCAACACCCAGTGTGTATAGGCAGACTAGCCAGCGGCTCCGCCGCATGTGCTGAGGGTTTCACCCGTCGACATGTTTCACACGTACGCACATA
GTTGCTCACCTACTTGTATAGTTTGGGCCAGCAATAGGCCTGTCTCACTGAGCTATAGGCCTTCTCACGACCGAGCTGACCACTTAAAGCGGTATCATGT
GCCTCATAGAGTATTCTATACTTCGACTTCTCATCATGAGAGACAGCGATACGAGGGTTATCCTCAATATCGGTGCGATAACACAACAGGCCATTATCGA
TAGATTATCGATGTAGCCTCGCACGTAAACGTGCCGACATTTCTATGTCCTAGTCTTTAAACTCCTCGCTCCCAAGAGCACATAGCAAAGCTACACCTCG
TTCATCCTTGGCATAAGCCGCACGGATTAAGTCAGTGACTGACGATGACAGCGCAGTGACGTGAGCAAGCTCATAGTCAGGTCGGCGCGATAGCACATCA
TCCAAAGAATTTTGCTTTCCTGGCTTATACTTCACTTCGAAGTTATATTCGGCAAAGAATGAAAGACAACGAGCCATTCTCTGAGAGAGGTGCGGCGACT
GTGTCGCAGTGCGCAATGATGCATGATCTGTATAGATCACAAATGGCTTTGAGCCAAGCAGATGTACTCTGAATTTGACTAGAGTGTACTTCATAGCAAG
TAGCTCTTTGTCACGAGCTGGATAATTCTTTTCAGCAGCTTTCAGCTGTCGAGATTCGAATGCAATGACGCGTTCGCGTCCATCGACATCTTTTTGTAAC
AGAGCACCGCCTATGGCAAAGTCAAATGCGTCACAGACAACACTGAAAGGCCGATCAGGATCGAGCAAAGCCAGTATTGGCGCATGAAGGAGACTTTCCC
TAACTGTTTGAAAAGCCTCATGTTTGGTGTTACCCCAACACCAATCCACATCCTTCTTAAGGAGATTGAATACTGGCCGAGCCATATCTGCGTAATTTGC
ACTATACTTATGCAAGTTGGCAAGGCCAAGCCACTTACGTAAATCTTTTTGGTTCTTTGAAACCGGCCAATCGACAATAGCCCTTACCTTAGCGGGGTCC
GCTCGAAGGCCTCGCTTCCCAATGACGAACCCCAGAAAAGGAATCTCTTCTGCACCAAAGATGCACTTAGATGAATTTGCATACAATTTATTCGTGTGCA
TGCACTCAAGCACCGCTCGTAAATGATCAATGTGATTATCCACATCAGATCGACCGTTCGTTCCACGACTATGGACAAAGATGTCATCAAAGTACGTTTG
TGTATAGCCTCGATGAGGTCTGAATAGTTGCATCAC