Description :
From Genome Similarity Track
Location :
Scaffold_264:28121- 29228
Transcript NameFunction/comments
g10084.t1hypothetical protein

Sequence
1107 bases(100 bases per row)
CACTCCTCATCCTTCGTAAGGAGATTAGACAATGGCCAAGTCATATCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAGTTGGCGAGGCCAAGCCACTTAC
GTAAGTCCTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGTTTTGACCTTAGCGGGATCCGCTCGAAGGCCGCGCTTCCCGATGAAGCACCCTAAGAA
GGGAATCTCTTTAGCACCGAAGATGCAATTGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAATGGTCTATGTGGTTG
ACCACATCTGACTTCCTGTGCTCCGCACGACTGTGGACGAAAATGTCGTCGAAGTTAGTCTGTGCATACGCCCGATGGGGCCGGAAGAGCTGCGTCACCA
GACGATTGAACGTCGCAGGCGCGTTCGACAGCCCCTGGGGCATCATCAACCACTCCCAGAGCATGCCGCTCGGGGTGCTGACCGCTGTCAGCGGAATGTC
GCTCACACGCATGAGCAACAGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCACGTCGTTCTGGAGAACATCCTTCCTAGGA
ATAGGCGTCTGCGCCGGAATGGTGGCGGCTTTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACACAGAATGTTGGCATCT
AGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGCTTCGCACGGAAGAACGCGTCAATGGCGTCACACTGCTCCCTTGGCAAGGGCCACTGCCT
TGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACACCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTGGAAACGACATCTTGG
TATTCCTTAACCAAGGGATAGTACGGATCTGAAGGATTCTTCAGGATCGCCGATCCACTACGCGCACAAAGCGCCTGATTCGTACTGTTTCATCCATAAG
GGACGACGAGTTTAACTCATCTTCAGGTCGTATAATAGCGACCTCGGCTAATTCGCCGGCCTTCAAGGCCTTGCCAAACTCGGCAATTGATATTTCGTCC
AGCTCTA