Description :
From Genome Similarity Track
Location :
Scaffold_163:28119- 31341
Transcript NameFunction/comments
Physo_144036hypothetical protein
Physo_144037hypothetical protein

Sequence
3222 bases(100 bases per row)
GTAAGACCGGCGGAGATTCGAGTAATGACGAAGAAGTCGCAGTTGACGCGCTCCAGACGCTTTTCCACTCCGAGTACATTCTCTTGGCTGAGTACATCGA
GTTTATAGTTCCGATGCTGTACTTGCTGTACCTTGTCGTGTTGTTCCACCTACCAGTGGCAGCCTACTACCCGCACACAGCGTCAATCACTGAGCAGAAG
TTGAAGACGACAGTGATGAACATCATGATTTACGGCGTGATTGAGTTCGCCTCGTTCGGCGCGCTCCTCGTGCTCTTGAGACGCAAGTTCGGCTTTTCAC
CGCTGTATCAACTCGCGTTTGTACTCGAGGCGCACGCTCCCGCATTGCAAGGCTATCTCTTCGTGTGGACCATCACGATCTTGCATCTAACGCTCAAGCA
CTACGGTACGCAATTTGTGATGGGAAATAATGTGGTCAAGTATCGGCCTAACAGTTGCGCTGCCTGTCATCTCCAGGTGTCGATTTCAATATTCTAGCGA
CGTGATCGTGGCTTTTGGCCTCTAAGCTGCAGCTATCTACTGCCTGGTCCGCCTTACTGACGCTGTCCCCTCACTTTCTTCTGGGATGGCAAATGGGAGT
CGCGTAGCGAATAAACAGGAAGCTCCAAGTTTTGCTCCTTCTTCGGAGCAGACACAAGCGTGTTGCACACTTCGCCCAACCGCAGCAGGCTTAAGTACAT
GCCCAGCGTGACACCGTCGGCAGCACACCCGACATAGCGGCGATACTCGACACGTCTCACATTGCACGAAGATGCCGAGCACACTCCGCGTCGTGGTCTG
GGAACTCTTGCAATAACACAAGGAGACTACGGACAGCAGTTGAGTAGGTTAGTTCCAGTTCATGGACGCATCAGCAGCACCCAATCCACCGACCGACCTT
TGCTTCCCTGCTCCTCGTGGCGTACAGCAGAGTCAACGCCGTCTAACGGGAACTTCCTCCACCTATCGATTTCACCGCCTGCACAGTAGCATAGCAAAGC
ACAGTCTCATTGTAAATACTCTGCGTATTTTATCCACAGCAAGTTCAATCGACGTACTGAGGCGGAGTTGAGCCAACGAGTGGTGTGTTCCAATCGATAT
TTGGGTGACGAAGCTGCTGCTGGGGATCGCTCTCGGTAGATCAACTTGCCAGGGCACAAACGTCGTCCGTCCGTCAGCTCGGCAAGTCTTCCCGTAGCGA
GCGTCGCCCCAAGTGAACACTTCGCCATCTCCCGTGAGAGCTGCAGAGTACTGTGCCCCCGCCCCGATGTCTGCAACGTGAACATTGACGAATTCATCCA
GAAACGACGGCATGTCGACGTGGTCGGCACTCGATGCGACGCCCAACTGGCCGAGCTCGTTGCCTCCGAAAGCGTACAGGAACGTGTGAGCGCCGACGCA
GCACAGAACCAGCGAGTGATCCGCTCCAGCAGCAACTTTGGTCGCCCCCAAGCCTCGGAAGAATGCGTTCTCACTTGGTAGCAACTCATTGTTGGACCCT
CCCAAGCCCAGACATCCGTGCTTCCCTCGCCCCCACGCCATCACAACCGATCGCTCTGTTGCTGCAGACTCGCTGGTTTGCGCTGGAGATGAGGGCTCGT
GTTGATTTGAGGGAGGACGCTCGTCTCGTGGCAGAAACACGCCCAGTACGTGACTCGATCCAGCGGCGATATCAACCGTAACGTAGTCTTTCAGAGATTC
AATTCTTGCTGGAGTACTTACATCGACCACGCCCCCGTTGGCAAGCTGACCGAAGCACCCTCTTCCCCAGGAGAAGACGGCTCCAGTTGCAGAGACCGCG
ACTACGAAGTGGTTCCCAGCGGAGATCTTGATGATGCGATTGTCAGCCAAACTCTCCACCAGTCGAGGGGTTTTCTCCACGATGACAACCTTGGGCACTG
GTTCTCCCTCTTCTTCATCTTCCTCCGCTTCACTGGCAGAATTTTCCTCACTTTGCTTCCCAGGAGGATCTTCACCTTCAACGATTGCATCGCTCTCGCC
AATAGCAGCGTTCAATGCGGATGCTAGCTCCAATTCCTCGCCGTGCCCTAGTTGACCGAAAATCTGCGTCCCCCACGAGTACACACGACCTTGATCTGTA
GTGAAGAGCCTGAGTGAGCACAAAACCCTTCAGCCTTAAGCCCCTTACAACACCATAACTCACCATCGAGTGCATACGCTGCGAGGTGTCCAGACTCCAC
AGCCACGATAGTCACTCCAGTAGAAATGGCATCGACACTCGCCATAGTCACCTCGACGGGCTTCCACATCTTGCAGCCGTCCTGCTTCATGAACAAGCGC
CCGCACTGGAAAACTCGGTTGTCATCTGCGCTAACAAGCCACACCAATACAAAAACAATGAGGCGATGACAACTAGTAACCTCTCAGGTTTCAATCACTT
TCCTTACCAGTGAGGAAGAGGCTCAGTCGATTTCCAGCCGAGACCGCTCGGACGATGGCACGGCGGAAAATCGCCAGTCGCTTCATCTCCACCACGCGTC
GAGTGTTGTGGTGCCCCAGAGCCCCATCCGTGTAGCCATACCCCCACGAAACAGGTCGCGTCTCCAGTGACGCTCGCTGTGCTGCTCGAAACAAGGTACT
GGCAACACGGTACGCTTCTCCGAGCGTCGAACCCGGAAACCACGCACTATTCGGACCCGAATCCGTCGGTGCCAGCCCCTTGAACGACTCTCGCTCGAGG
AACTTGGTCGTCTCATGATACTTGGGTCGTCGCACCACTCGCTTCCTCGTTCGGGTCACTGGCGTCGCTGGATGCGGCTCCGAATGAACTGGCGGTACCA
CGACAGGACTAACAACACGTGAAGTCTCTTGAGTCTTCGACGCTTCTGAAGCTGCAGACGGAGGCTTGTGCCTAGCAGTCGGAGATGAAGCTTTGACCGC
AGCGCGAGGCATCGCTACGCTGGACTCGTCGCCGGCCGACCTTTCACTGTAGAGAGTCGCCACCAAACGAGTTCAAAGTCTTCCATCCATCCATCCTCCA
TTTCAATGTCCTTAGCGAGAAATACTCCTACACCTCCTCTAGTCCTCGGCATTTGGGGCGCTTGGTTGGATTGGGGACAGCATCCGGTGCTGGATCTCGT
AGATCGGAGACGACCCGCTTATCCTTCGCACGTCGCAGAGCAGCGTGAACACACCGAGCAGGCTGAAGAGCAGCTGGAAGGCTCCAAACGTGATCGCGCA
CGTGCTGAGCAGCGAGTAGTTG