Description :
From Genome Similarity Track
Location :
Scaffold_58:281169- 282912
Transcript NameFunction/comments
Phyci_93833conserved hypothetical protein

Sequence
1743 bases(100 bases per row)
GTTCCTTACGAACACGTTGAAGCCACGTCGCTGCCTTCTGATACGACCGGTTTAGCGCATAGGCTTCCTCGAAGCATGTTGCAGCCAATTCCAGCTGCTT
CTTGCTGTAGTGGCAAAGCCCCATGTTGTGACTTGTCACGTGATGCTTGCCCATTTCTTGGGCGGATAGCGTGTAGTAGGCTAGCGCGCTGTCGTACTCG
TGCAAACCGTAGTAGAGGCGGCCGATCTCAAAGGCCACATCCTTCTCCTTGTCTAACGCGTAGTAATTTTTCCAGACTTGCGGGATACCATATATCACGT
CCTGTTTGAGCTTGGCAGCAGCAGTCGGGGACTGGTCGAGCAGCACGTCACGGAATTTGTAAAATACATCTGGGTCCCACCCACTTAACTTCATCAGCGC
AAGTACGGCCTTCAATGATGGAGCTTTGGCATCTTCCTTCGTCGATTTCTGCATCACGAAAAAATCGTTGGGGCCAAAAGATACGATATCGTCCTCAAAC
GCTGTCGTAAGATGTGGGAACTGGAGACTACGCTTCGCACACATCCGGTCCAGTCCGTCACCGTAAAGCCCCGTCATTGCCGAGCTGACGGTCTCACTCG
CACCCACTGCGTTAGCAGGTAGCACAAAGGCAGACACCTTGAGGCTGGCCTCTTCCTGTGGACTGTGCAATGCGAAGCCGCCCCGGCTTGCAAAGTACAC
ACCAATGGCGTGGTAGTTAACCATAACGGAGAAACTGCCGTGTACAGCGATGTGTGGGTCGTTGACGCCGCAGAAGTGGTCGGGGTTGTTGTTTCCCTTG
TCACCGGATAGCGTGACGAGCCCGTTCTTCGAAAGCGCGGCAAGACGCTCGATAGCCGACAGAGCTCCGATGGGGACCAGAATCGTGGCACCCGAAGACG
CTGGATCGAAGTACTCGTGGTACCACTTCAGAATGTTGTTGCAGTGAGGTCGCGTCTCTCCGTAGTAAGTCTCGTCGATCTGTTCGTACTTGAAGATGTT
GTTCAAGCGCTTGATGATCTCAGGATCGAGTGGATCGGGCTCCTCGGCACGCTTGGAGCCGACACTCACAAGCCCCTCTTTCAGCACACCACCGTCCACT
TGGAACAGGTCGTGGTACAGCGTGTCAAACAAGTAGTTTGCAATCAGACACAGCGGGTTCGCCAGCTCGCCGGGACGGATGACCTGACCGGATGAGTACA
GACGCAGCTCCGTGTCGGTGGTGGCGTCGAAGATGGCGAAGTCCACGATCCCGCGCTTGACGAATGGCGCCAGCGCCGGGTGTGTCTTCCAGAAGTTGAA
GTTCTGCTCCGTGAAGTCCGTCATGATGTAGCGGATGTTGCTCAGCGGGAAGTCCAGCACGCTCTGCAGTTAACCAACCACCACACAACACGGTACACTA
CGTCAGCAATGCACATGAGACACCAGTAGGTTGCCAAGCTCACCTCCACTTGTGCGAGCGCCTTGAGGAAGTAGAAGCTGAACTTGCCCGATCCGGCGCC
GAGCTCCACGATGTAGAAGGGCTGCGACGCGTCCACCGGCGAGGCCGAGCCCGGCCGCATGGCGTCCCGGAAGTAGGCGCGCAGCACGTTGCTGTAGCGC
TTGGCGATGAAGGTGTTGGACGTGATGAAGTGCGGCACGATGCCCTGCGCCCAGGACTCGACGCCCTGGCGGTCGTAGAAGGACATCATGAGCTTCCAGA
GGTGGCAGCGCGCGAAGGGCGTGAAGTCCTCCAGCTGGCAGCG