Description :
From Genome Similarity Track
Location :
Scaffold_172:28114- 31045
Transcript NameFunction/comments
g6222.t1hypothetical protein

Sequence
2931 bases(100 bases per row)
CGGGCGAGTCCAAGCGCTGGCTGCAGAGCCTGGAGAAATGCATCCGCGCCATCGTGAGCATCCGCCTGCTGAGCGTGCGCGCCTTCGACGGCAACGGCGC
CAGCTTCAGCGTGGCCACGGGATTCGTGGTGGACATGGAGAGGGGCATCATCCTCACGAACCGCCACGTGGTGACGCCCGGACCGGTCGTGGCCGACGCC
ATTTTCCTCAATAAGGAGGAGGTGGATCTTGTGCCCGTCTACAGGTGATGACTCACCCTGACCCCATGAACAGAGGGGAGATGGGCTCATTGCTTTTTTC
TTTGCTGTTTGGCCGTAGGGACCCCGTGCACGACTTTGGCTTCTTCCACTTCGACCCCAAGAAGGTCAAGTTCCTGCAGCTCCACGAGATCCCGCTGCGA
CCTGAAGAGGCCAAGAGTGGGTGACGATTAACGCACGAGTTTCTGCATTTTAAGGGGACGTATTGACGGGTTTTGGTGCTTGTTGCTGTGACTTTCTTAG
TCGGTGCGGAGATTCGTGTGGTGGGCAACGACGCTGGCGAGAAGTTGTCCATCTTGCCGGGTATTTTGGCCAAGTTGGACCGCGACGCGCCGTCCTACGG
CTCCAGCACGTACAACGACTTCAACACGTTTTACTTTGCAGCGGCGAGCAGCACTAGCGGAGGATCGAGCGGCTCGCCGGTGCTAAACATCGATGGGTGC
GCTATCGCGCTCAATGCGGGTGGAGCGAAGAAGGCGGCGTCGTCTTTTTACCTGCCTCTGGACCGAGTTGTGCGAGTTCTTGGACTTATTCAGCAGGGCG
TGCCCGTGCCGCGCGGCACAATTCAGACTATTTTCCGTCACACGGCATTTGATGAAGTGCGTCGACTGGGTCTTTCCGGCGAAACAGAGGCGCTGGTGCG
GCAACAATTTCCGCAGGAGACAGGGATGCTAGTGATAGACCAGGTCATCCAGGGAGGACCGGCGCATGATCAGCTGCGGACAGGTGACGTGCTGATCAAG
TTTGCCGATCAGTACGGGGCAACGTTTCTAAACATTGAAGAGTTCCTGGATTCTCATGTTGGAGAGACCGTCGAAGCTCAGTTTCAGCGCGGAGAAGAAC
AGTATACAGCCACCCTGAGCGTCCAAGATTTACATTCTATTACGCCAGACAGATATTTGGAAATTGGAGGTGGCATCGTGCATGCACTTTCCTACCAGCA
AGCTCGCAACGCTTCACTACCTGTCGGTGGCGTGTATCTGGCCCAAGCAGGTCACATGTTCATGAAAGCACATTTGGCCCAGCCCTGCATCATCACATCC
GTGGCGGGGCAACCCACTCCGACATTAGATGACTTTGCGCGCGTGATGGCCTCACTGCCCAACGGATTTCGTACGGTATTGCGCTACTTCATGATTCGCG
ATCGCCATCGTGTCCGCACAGCCTTCATCATGATGGATCGTCTTTGGTTCCCAATGCAGATGTGTACGCGCAACGACGAGGACGGGCTGTGGTATTCCAA
GTCATATATTCAGGATGATACGTCATCACTTGTGGCAGCTACAGACTCCAATCCGACATTTGCCCCAGCGCCGTTAAGCTTTCCGGGAGGCAATGCACTG
GGCAAGAAAACGTTGCTGTCCCTTGTAATGGTGTCATTTGACATTCCTTATATGATTGATGGTATTTCGAGCTCAAGCTACCACGGAATGGGAGTCGTGG
TCGATGCTGAGCGAGGCTTTGTGCTTGTGGACCAGAATACCGTCCCCATCGCGTTAGGCGATGTGTTGATTACGATTGCTGCTACCGTTGAGATTCCTGC
CAAAGTGGTTTTTGTGCACCCAGTCCACAACTTTTCGATCGTCCAGTACGACCCAATGGCACTTGGTGCTGTAGCCAGCCACATCAAAAACGTAGTGCTG
GCGGATAAGCCGTTGGAGGTGGGCGAGACAGCCGATTACATCGGCCTCAGTAGTAACTGGACTGTGGTTACCATGAAGTCTGTGGTTACTAAACTAGACC
GTCTTGTGCTGCGCGATTTCCAGCCGCCGCGCTACAAGGCGTGCAACATCGAAGTCCTGCATTTCGATCGTATCACGAAGTCTGTAGGCGGTGTTTTCAT
TGACGACCAAGGCGCTGTCAACGCACTCTGGCTTTCATTTAGCTACCAGGACAGTGCCGGCCGCAAGGAAGTCTTTCGTGGCCTGCCAGTTGAGATTGTT
CGGCCCATCATTGACGAGCTTCAGACGTCTCGTATCCCGGCATCAATCAACATCCTACCGGCGCAGTTGTTGACGTACTCGCTCTCGAAGGCGCGTTCTG
GTCTTGGACTCTCGGACACATGGATTCAAAAACTCGAGGCCTGTTACGAAGACAAGCGGCAGGTGCTCGGAATCAAAAGATGTGCTGCTGGTACGGACTG
TGCCAGTAAGCTTGAGAGCGGCGACTTGCTTCTAGCTGTCGATGGGCAGGCTGTGGTGCGCGATGCAGATGTAGAGCGCGCGGTTGATGGTAAAACAGAG
CTGAAGGCTTTGGTGGTGCGTGATCAGAAGGAAATGATAGTTACTGTAAGCACATCTCAGCTCTCAGCGATGGGCACAGATCGTGTAATTGTCTGGTGCG
GTCTCGTCATTCAGAGTCCGCACTACGCTGTCGCAAGCCTGGGCTATATTCCGGAAGAAGGCGGCGGTGTGTACTGTTCGCGGTGGTGCTATGGATCCCC
AGCGCATAAGTACGGATTGCGAGCAACCATTTGGCTTGTGGAAGTCAACGGTGAACCTACACGCACGTTAGACGATTTCTTGCGTGTGGTAGAACGCCTG
GAAAACCGAGAATCGGTGCGTCTGAAAACGATTTCCATCAACACGAAGCCTAAGGTATTCACGCTCAAAACGGACTATCACTACTGGCCTACGATCGAGC
TGCACAGAGAGGAATGGGACTGGAAGTATGT