Description :
From Genome Similarity Track
Location :
contig_265:2811- 3909
Transcript NameFunction/comments
g12259.t1hypothetical protein PHYSODRAFT_344027

Sequence
1098 bases(100 bases per row)
CCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTTGAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGA
GAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAGCCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCG
TCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGACGTACGGGGCCTCGTCGAAACTGGGAGCGACCACGTGTTGCGCTTCCAGTCGGCGAG
GTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTGGTAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAGA
GCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGCAGCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCAT
CAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTAGCTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCCA
GATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTCCGAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGCC
TGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTGCCAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTAA
TAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCCCCAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGACC
TCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAGCGGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCATGCTCTCCACGAGA
ATGTGTTCTCTCTGCACGCGCAGCTTGATGCGTCCTTCTTCCCACGGCCTCAGCAGCGCGCCCATGCGTTCCAAGAACCACGCGTACTTCTTGGGGAA