Description :
From Genome Similarity Track
Location :
Scaffold_531:2810- 6736
Sequence
3926 bases(100 bases per row)
ATACGTTTTTGAAAATCAAATTGATTAATAGCTGACATATTTTTTATTAGGTCATATTTTTTGGAAAAAACATATTTTCAATCTTATTTATTCAGATAAG
ATAAATTTTATTTTATACAAGGTGTGCGAGTATTTGTGCAAATCCACCGCTAAGCCAAGATACGTTCGAAGTCCTTTTGCATCTAAATGCACCGCCTAGT
CGGTGATCGCCTAGATCTTTTCCGGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTGAGGCTGGTGTACAATTTATGATCACGAATAAGTGTAAGAACCTTCCGTACGTGGAGTTAGCTGACTTTCACATCCGTCTGTTCGACTGCATAGA
CAGACTAGCTGTCATCCATACGGGACGAAGACCGAATATTGTGCGTTAAATGAACGGGACGATCGAATGATACAAAAATCTTGAAAGACTGTAATCGACG
AGGAAATAATAAAAGAAGGATAACCTCTTACGTCGATGTATACCACGACGGCAGAGATCTGCTCGCCAAAATGTTGATCGGTCTTGCACCAGAACTTGCA
ACAAATAGGAGATGAATGCTGATTGACGATACTCATATGGGCTATCCGGAAGTCCCAAGTATTAAAGATAAAAAGAAGTTGCAATCACTGGTTTACAAGA
ACGGCCATTAACATGTTGAAAAACATACATCTTACCTAATGGGTCACCTGAAGCGTTTTCGACATAGATGTAAGAGAAATCAATAATACCGCGCAATGGG
TCCAGCCTGTAGCACCCAAATTATAAAAAAACAGGCCGATCTAGTCAGTGGAATTTATCGCCAAGATTTTCCGAAAATCTGTCGCACCACGGGCTTCGCT
AATGTAGATATCATCAAAATAACGGCGAGCACATACGGCTGTGTATTGATTACAGGTTGGTGATTCAGCTGACAAGATTAATGGTATACCCTATGCCTCA
GAAGTGAAGTATTGCTGGACATAATAAGAGCTATATGGATTTTTTCCTTGATATGACGAGTGGGTTCAGGGTGGTTGAGACGACGGAACTAGCAAAATCG
ATCTTATTATCATCACATAGTCGGTTTTGTAGTGATTAAAGATGACTTTTGGGGTGGTGTAGATTTACCAACATTTGATTGATATCGATATGTACGATAC
GTGAAAAATCTTGCAGGGGACTATTTAGTATCTACTGGATCGTCAAAGTCTGTCGATGCACTAACTGAAGGTTTATTAGCCACCGATCTAAGATCATCGG
TTTTGGGTCAGAGATCGCTTATCGATGACATACTGATAACTTCTGCATTGTGGGATTTCCTATACAAAAAAGTGAAGTAATTGTTCAATTAGTGAAATGG
TTGTAATATTTCGATCATCTGCGCTCAAGGTTTCTAGGGACGTGATAAGGTGTAATAGATAGGGCTTAATGTTTGCTGGCAGGTTTGGAAGCTAATCCAA
AAATCTGATATTGCTGGTGCGTAACCATTTCCTCGGACGCTACGATTGATGTTGTCAGTTCTTCGAAGTATAAATTACGATAGTAGATTCATTGAGAACT
TTGCAATATATGCGTCCGTGCTGTATAAGATTTTTGAAGCATATTTCCATGACATCAACCCCGCAAGTCATGTCAGACGTCGATCCTTGATCCAGACTGG
ATCGCGATCGCAACTCCCCGAATATATACAAGCCCGATCTCGACTCAAAATAATGGGGATGATTAAGATTCAAAGGGAGGTGATGTTGGCAAAAGTATGG
TATCGCCTCAACGTTTTTTGAAAACAAAGTAGCTAAAATGCTGATTTTGATGCATTTAGATCAGGATCGGCTGCCGGTGATAGTAGTATATGCTACTAAG
TGGGCACTGTCGGCTGCGTTACTTTTTGAGCACGAAGGTGTATACTAGACGGTCAACTCTCCGATCCTACGCTGACGACTAACCAATTTTTTTAATATGG
TCAAGAATGNNNCAATAGATTTTCTTCAGATATTGTATATTACTTACACTGTGCTGATGTCACACATGATTGCGATGCATACGTGATCATTACACTGGCA
TGGTTGCTACCATCTGAGTGTCTCAACAGAGATTCGGGAAGGTCGGTATACTTATTTTCAAACTGTACTTAGAGATCTGCCAACCTAAAAAGGGTAAGAT
GAGAAACTTGGCATGCTGGATTCAAGTATACATCTCGCGAAGTAGTGAATGAAGTCTTAATAAGGATTATCCCACGAAAGTAGCCTATGGTTTTTGTCTA
CTCTGACGGTAGGAGGTGGCATGCTTAAGCAGCCAGGGCAGACAATAAGAATGTCACCTCTTACCCTCAGAGTAGACAAAAACTTCTAGTGGCCCATTTT
GATAGGTCGTCTAGAATGAAGCAGAATAGTGGGGCAATAAGCAAAATCGTATAGACTTCGTCGGAATATAAGATCGTAGTGGATGCTTCCGTGTATACCC
CTGATCTGACTATGAAAAAAGCGTAGTACCGAGTATTTCTCCTCTACTTTAACTAGACCGCTGATCAACCAAGGAATTGGTAATTATTTGCGAATACTTC
AAACTGAATGATCTTTCAAATGCGAAAATAGATTGACTGCAAAGCACCAGGGTTGAATTTGCTGCATCATACATATGTAAAGAGACTCATTGTGGCCAAT
TAATAGGTTTTTACATATGAAGTGGGACTAGTACAAGTGTATAAATTAGCTAGCAAGCGGGGATCTACAGCGAGATAAGAGACTAATCTCTGATCATGAC
CGTCTGGACCTGATCACTCTTAATCAGTTAGGATAACTACTACTACCAGAATGAGTCTATAACTTATTTAATGGGGTCGCAGGTTATCAATCTATCCGCA
TCGAGAAGATGCTGCCAGAACAAGAATTTACAGGAAGCGGTCGTGCAGAAGTATGGATCAATCGTATCATCCAAGAGGAAGACTAATTGCTATATAACTT
ATATTCATTTATATATTTTTGAATGGAGATGTGGCTAGGCTATCGGCGACAGAGACAAACGCTGTACCCTATTCGCACCTAATAATGAGATAAATCAAAG
TGGATTGCTATATTGATGGAAGAGGTCAGTCACGCAATTGTAATGTCGTGCTTAGGCGGTTAGCTTGATAGGTCCTAAAGTTCCTACAGCGAAAATGATT
GCACCACTACTATACAAGTCTGGACGGTGGTGGCTGAGGAATTAGCCGCATCCATAATAAATTCTCATTGGACAAGTTTAAACAGAAATGTGCAGCGGTA
TGTGGTATAATATGTTGATTTTGATACGGTACACGGATAACTCTATGATCGGAGCGTATCTCCTGATAATTTACAAGCGACATAGCTTTTTAAAGTATTG
GACAACAATCACATTTCTTCATTGCCGCGATCTTTTAAATGGAACATAGAGCTTTTATGGTGCATTAATCGTTTTCTAGGTTTATGATCGTAACATCGAT
TCGTCCAGAAATGCACAATCTCTTGCAAAGAACTGTGAATTATTTTTATTTATACAGATTGGTGGAAGCGAGGCAAGTCCAATTTCTCTCGAGCGCTAAA
TTAGGTCTCGGAAAAACGGCGATCCACCATGGTAGGTAAATGGCAAGCCAATGATAAATAAATAAATATGGTGCGGACACTTACNNNNNNNNNNGATCAA
GAAGCGCGTCAGGGGCGGAAACATAAAGATTAGGACTAATCGGTATTAAGATTTGTTTATACATATAGTTCCCGGAGTATCAAGTGAGTTAGGGATAAGC
CATTTTGCTTTATTCACGGGTGGTACGTACGCTTGACATTTAAAGCAAACTTTTCGCTAGGATCGGCCTGGCCTTTGAAATTTCGGACCCACGATGGTGG
CGTATGGCATACAACACCAGTATAAA