Description :
From Genome Similarity Track
Location :
Scaffold_2580:2810- 4000
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2580-fgenesh-gene-0.1Carbohydrate-binding protein

Sequence
1190 bases(100 bases per row)
GCTGCTGGTGGTTCTGGTTGTACTGGTGGTGCGGGTTGTTAATGTCGCCACCGAGCGGCTGGAAGCTCTCGCGCGAGCTCTGCTGCTGGTTCTGCTCGTC
CTGCTCGCGCTTCTCGTCGTCCTCGCGCTTGAGCTTCCACGTGACGTAGAAAATGTACATTTGGCGCACCATAAGACACACGAGCACGAGGACCTGGAGA
CCAATGATGGCAAAGCCCACGCCCTCGCGCAAGTCCACGGGGATGTCCTTTTGCAGCTGCGTGGCCGACGAAATGAGGAACAACGTCAAGAAAAGCGCCG
AGATCTTGATGATGATGACAAATGACGACGTCTTCTGGACAAACGCCGTCGGATACGGACGCTTGACCTCCATGTAGAGCAAAAAGGCAATGTGGAGCGT
GATGAGCACGCAGACTTGCCAAATGCCAGGCATGCCAATGAAGCCCGTCGTGACGCCACACAGCAAGGCAAGCATGAGCTTGGGCGCAAAGAAGTAGCGG
CCTTCAAATTTGTACTCATCGTAGAGCGGCCCGTACCGCGCGTGCACGGGCTTTTCAAAGTGGTCTTTGGTGCCGAGATCGCGGAGATCGTCTTCGTGGT
GCTTGACGACCCACATGCCATAGAGAATCGTGCCGACGGCAAAGAAGATGAGCGAGAAGATAGCGAGGAACATGCCAGCATCCGTGGGCTTGTTGTACTT
GATGAGGTAGCAGATCTGGAACGTGGCCGTGACGCCCACGACGTACTCGGAGAGAATCAAAATCATCATGAGCACACCGACCGTCTTGTCAAACCACTTG
GCGGCAAACGCGCGCACGTCCTCGACAAACGGCGAGGCCACGAGCACCAAGAGAGCGCAGAGCACGAACGGCGCGACACACATCATCATGACGCCAGCGA
GCGTGAGGTAGAAGAGCATGTCGACCTTGACGCCAATGAGCGCGGCGTACCGCTCCATGCCGAGCGTCTGGTTCGTGTTGGTCACGTCCATGAGGCGACG
GCTCACGACCGTGCCGTTCGTGGCAGTGACATTGTCGACCTTGCCAAACGGCAGGAACGAGAACGTGGATGGCGCCATGCGCTTGCCCATTTCCTGGAGA
AGCCGCGGCGTCGCGTCCAGGTTCATTTGGTTCACCATGACACTAAACTGGCAAATGTCGACAGCCACCATGGCGAGCCCCAGGCTGGCC