Description :
From Genome Similarity Track
Location :
Scaffold_2287:281- 3067
Transcript NameFunction/comments
Phypl_g14913hypothetical protein

Sequence
2786 bases(100 bases per row)
GATCACAGGATCTGGATCCCAGGTTCTGGATCGTACATCCGCCACCCGATCGCCGACAGTCCCACCGATCTAGGTCTTCCACACCCTCCGCGGGACGTTA
GCACCATCGATCCTCTTGTCAGCATGCTCCCTGTGGTAGATCCACAGCCTTGACCTCAGATCTGATCATCCAAGACTCCAGATCTCAGATCCGCAGATCG
GATCCGGAGTAAACGTGCCTTGATCTGCCTCACTTGATGCTGATCTGGTCTCATGCCGTCCCTCTCGACCACCACGCACGTCCAGGCAAGTCCACATCGC
TATGAATCATCCGGCGGGTTCGCCcccttgctcttcgtcgtaGTCTGGCCTTTGTATAGCGACCTGGTTGTGATCTGGGGTAATGGGTACATGGTTTCAA
CCAGCGACCCCTGATCCAGAACAGTGACACGCGGATCATATCCCCGCGTACGCACTTTCCGTTCTCGCCGTTCAAAAGAAACTTGCTCCACCACAATCGC
CTCCTGCACGTAGTTGTTGCCATCCAACGGCATCACTCCGTGCACTTGGATATTTACTCGCATCTCCGACCCCGAGTGTGTCTTCTTTGTCTGATCATTG
AGGTTCTGCTCCAGTCCGCCTTTGATCGTCGTAGACTTGATAGCCGCCCGGCCTTGATCACGCTAAAATCGACTTGGATCTTGCGATCTGACACCAACTT
CGTCAGGTCTGTCATACACAACACGTACCACCTTCCTCCAGCCTGCAGCCACCCTGCAGGCTCAGCAACATCTCCTCTGTCGACATGACCAACTCACGTC
GACAGATCGCAGCCTCACTGCTCCTCGTGAGATTGCATCACGCTAAACCGGTGACGGTTAGCGCGATCGCGCAGAAACGCATGTAACAATGCTCCAGAGT
TCAGATCGGCTTCGTCTACCCAGGTAGGATCGTCACAGCCTCGCCAGTGTACCAGAAATTCACGGAAGATTCGGCTATACCTCGTCTTCTTGCCGGATCG
TACATCGGAGATCTTCTCCACCTCATATTCATCCGACCCTAGCTCCCGGATCCAGCTGTCTTCAGGCGGTAGTACTTCATCTAAATCAAGCCGATCAGCT
GCGTCGATCGTTAGCTGTGCTTGTGGGTGAACGAGGAATTCCTTCACCAGTTTCAACTTGGACACATGCACTACAGGGAAAAGGCGGTACTCCGTTCCCG
AGATCTCGAGTTTCATGGCGTGATCGCTAATTTTCTCGGCTACCCGGAAAGGTCCATGCCACAGGTGTGCGAGTTTTCGAGCATATCTTCCTTGAGATGA
TCTAGATAAAGCCACACTTGAGATCCGACTCAGATCTGGTGTGGGCGGATCTCGTCATTGTGCCGATCTGCCCGATCTGCGATCGCTTCCCGCAATCGCT
CGCTCACATTTTCCCGTGCTCGTTGGTAGTATCGCTGGATCTGGTATCGCCACCGTCGCGGATCCCGATCCTGACGACGGGTACTCCCCACTGGGATCGT
AGCCTCGAGTGTGGATCTAGGATCCCAGCCATGCACCAAGTAAAAGGGTGTATCCCCACGGATCCAATCCTGAGCGGTGTTGAGCGCATACGTGAGACGC
TCGGCGTACTCATCCCAGTCTCGTTGATCCAGATCCTGGACGTACACCTTGAGTGCCCTAGTCACAGTCTGCACCATTCGTTCGGCGGTTCCATTCGCTT
GAGGTAGGTACGCCATCGTAGCGCGCTGACGCTGCCCCAAGATCTTGTTAAATGCGCGAAAGAAGTCAGACATAAATCCTGGCTCCCGATCATGTCGGAT
CACTTCGCTAGCTCCAAACCTGCGGAAGATGCATTCCTCGTAAGATTCTGCGATCGTCTACACGGTTCTTGAAGCGCTGGCCTTCACGATCGCATAACCG
GCGAACAGATCTACCCGGACCAATAGCTCTGTATTGCCCTTGTACGATttgggcagcgacggcgtATGATCCACAGCTATGATCTGGAACGGGTAGGTTG
CCTGGATGTTACCTGGCGACTCTCCCTGGATCGTAGGTCACCCTTTTCCGGTTTCACAGTCGACGCACTCCCCCACGTGACGCTGCGCACTCCGATAGAG
ACCCCACCAATGGAAATGGTCCCTGATCCGTTGATATGTGCGGCCGATCCCCTGATGACCACCTTCCAAACTCGCATGATAGTGGTGCAAGATATCCTGA
TGCAGAGATTCCGGCGCCACCAGTCTCATGAGGCCATCTCGATCAGCGTCCGCACGTTTCGTAGGAGGACAGTAGAAAAGCAGATCATGAAGATTCACTT
CATAATCCAAAGCAATGTTACCGCAGGATCTAGCCTCTTCTTGAGTCAGATTACCCACTTGTCCAGCCAGATACTTCTTTAACCTCGAGATCCACGCCTC
CTCGTCTTGCGCCTGTTTAATCCGCTGGATCCGAAGGTCCCGCACGAACTCCTCTTGTAATACCGTGGGTCTCGATCTGGGTCCGGGGTTGGATCTAGTC
CGTACAGGCGAGACTCGCATTATCTGATCTTCGGTCTTCGCAACCAGAACCTCACCTAATCAGTTCAACGTGGTTTGCCGTTCGAACTCGCTCTCGACTT
CGATCCCGTGCTGACACTGGAGGGCTGCTCCAGCCAGGCTGTCTGCGCTACCATTCCAATCACGCTTTACATTAACCAACTCATGACCTGGCCATTCTCG
TAACCGATCCAGCGCTTTCTGCCTCAGGAGCGTGAGCCCCGGTGCTTTGCAATCCATCTCGCCTCTCACCTGTCGAACAACCAGGT