Description :
From Genome Similarity Track
Location :
Scaffold_1930:281- 2667
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1930-snap-gene-0.1Liver stage antigen

Sequence
2386 bases(100 bases per row)
GTGTCTGGTGCTTTTGCGCTTGTTGAAGTCTTATGTTTGTGGATCCAGGTCGTGCCCCTTGGAAAGGTGCATTCAGCAAACCCACCACCACCATACCATC
ATCACCTAGTTTATAAAATCTCTTCGCTGAACGGCTCGGCTCACGAATCTTGAAGCTTGGAGGATACTGATTCGATCGAGGGATCGTGGCGCAACTCAGC
TCTACCTGCGTGTGGACTCGTTTGCGCTGGGAGTCTGCATGTCCAAACGCAAATGAATCTTCTTCTGACGTGCCCAGCACAGGAGCCCAGCACAGGAGCC
CAGCTGGTTTACTGTCTAATGCGAGCCCATCCAATCGGATGTGTGTGATATGTGCACACGCAGCATGCAGCAGGTTTAACACAACACCACGTGAGCAATC
AAACACGCAGTTACAGTTGAGCGACTGAGCTTCAGAAATGCTTCAAACAGCTGTTCGGTACGCTGGTCATCAATGTTGACGCTCTCTCTCTCACCTGGTC
AAACAAGCTTTTCACAGTTGCCATTTTTATTGGGAGCTTTTGACTGCATTACTCTTCATCTTCATGCAATTGGTCATTTAGTCTACAAGGAATTGAAATG
GTCAGTCTCGTATCACCAAACCGCTCAGACACTCGCTCAAAAGTCGGCAATGTCGGGCAGATCAGGAAGATCGGGAAGTGCAGGGGAGTTTGATCGTGGC
GCATTGCTGGACGATGGTGGTGGCGGCGGCGGCGGACCGATCGAAGCGGAAGGTGCAGCAGTAGCAGACGCCTGGGCCTTTGGACTCGGGAGCTGTGGAC
CAATGAACACAGTCTCTTCCTCTGCTCCAAAACTGCGTGGTGCACTGGAAGTAGAGCCTGGTGTCTCTGGATACGCTGCCGTTGGGTACTGTTGGTTCAT
CATTGGAGGTCCAGACATGTATCCAACTGGAGGCTGTTGGTAGTATTGCGGTTGCATGGGGACACCGGGACCGTACCCCATATTCGCGTATTGCGGCGGG
TAATACGCCTGGGGCGGGTACTGCGGTTGGTACATCCCGTACGGCGACGAGGCGTACATCGGCAGGCTCTGTGGAGGAGCTGGGTAGCCAGGAATGTATT
GAGGCATCATTGGATACGATGGTTGGCTCTGCGGAGCTGCAGGAATAGTGGTCGCTGGTTGTGATTGCTGCTGCTGCTCAAAAACTGGCTGGATAATTGG
CTGGAGAACTGGTTGAAGAACTGGTTCTTGATAAACTGGGCTCGGCGCTCCAGGTGTAGATATAGGTGCTGGGGTAGAAACAGAATGTGGCGGTTGTGAT
GGCTCTGCAATGATAACAGCAGGGGATACAGTAGCCGGGGAAGATACAGGAGCAGGTGCAGGTTGTTGAGGATCTTGTGCTAGGATTGAAGTTTGAACAG
GAGTTGAAACTGCAAGAGGAGGGGCAATAGTCGGGGCTGGTGGTGTCTCCACCAACACGAGTGCGCTCGACATCTCGGCAGCATGAGCTTCGGCATGGGC
TTCAGCCTCTCGCTCTTTCCGCTGGATCCGTTCAGCTGGCGTCGAGTACTTCTCTTTTCGCTTCTTTTTCTTCTCTTTCTTTTCGTCCTCAGCCTGTTGT
TGCAGCTGAACGAGTCGGAGACGCTCGACCTCCGCCTGCAGCTCTGCTTCTTTCGACTTGCGCTGCTTCTTCTCCTTCTCCAACTTTGCTCGCTCGCGGC
GCTCTCGTCGCTCTTTCCTCTCTCTTTTCCGCGCTTTCTCCTCTTCTCTCTCACGCATTGCGTCACGGTGTTGACGAGCAAGTTCGGCGGCAGCAGCGGC
AGCAGCCTCCTCTTCTTCTCTCCGCTGTCTCTCCTTTCTCACTCGTCGCTCTTCGCGTCTACGCTCTTTCTCGAGGCGTCGCTCTTCTTCATATCGCTCG
TCTTCTCTGTCAGCTTCATTGACAATCGAATCCGGCGACTCGAACAGCAACAGATCATCTGTCGGCGCAGTTTCATTGGACGTTTCTTCGTAACTCGGCT
TCTTGTGCTTCGATTTTCTTCTCCGAATAGGTTGCTCGACCTCCTCCTCTCTGCCACTGTTGTCGCTGACAAGGTCCTCGTACACTTCTGCTGGAAACAG
AGTATCCTCAGATGGTCGCACAATTTCACTTGCTTCAGAGCGTTGAGATTCCTCTAGCATCTGCTGCTTTTCTTTTTTCTTCTTCCTTTTGTTCTCTCGT
CGAACTTCTGGATCAATCTCAGCTTCGACTTCAATAATCTCCTGTTGTTGCTGGTAATGCGCTTCCGCATCGTCGACTTCATCGCGCTCAACAGCAGCGA
CAGCGTGAGATTTCTGTCTTGCATGCGTTTCTTCCTCGATGTCACCATTGTAATGGCTCGCTTCAGCAGTGATAGTGTTTGACTTT