Description :
From Genome Similarity Track
Location :
Scaffold_2733:281- 2011
Sequence
1730 bases(100 bases per row)
CACTTCGTCAAGTCGGTTCAACGTAACGAGATCCTGATGTTCGGCTTCTCCCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAACTA
TCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCG
GGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATTACCAGCCGCTTTGGATCTTGTCCCTTTAGTAAATTCAA
ACCCAGAAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAATCTCCACAGT
ATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCT
GGATCCGGCGTTTAGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGTTCGCGGCCAAGACTCCCAGGATCTC
GTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGTGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCGACTTGAACAGC
CAGGCTAGCGTGGAGTGTCGAGTCAGAATCCGGATGGATCTTCCCACTAGCAGGTTATAATTTAGATCCAACACGCGCAGGAGCGCAAGTATCTCTTTCT
CCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACAAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGCACCAGAGCTGCTGAGAC
TGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCAGTTCCACGAAT
GCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCTGGGGTGGAT
CCAGCTCCTGTGTTAGGTCCTCTTCTGACGTCATACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTCGTTGGATTTTCATCTGGAC
AGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCTTCGATGAACCGACTGTAGTAGTTCAAA
CTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCTAATCCCTCCTTGGAAA
CTCGATGGCCCAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTAACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCAC
TCTTTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCTCCTGGCTCC
CCCGCTTCGAATGGATCCACTTCTGCGTCACCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATGAGGC
GTTGGTAGATCTGGGGTGCGTTCTTCAATC