Description :
From Genome Similarity Track
Location :
scaffold_42:280976- 300618
Transcript NameFunction/comments
Plaha_PHALS_13906dead deah box rna
Plaha_PHALS_13907hypothetical protein

Sequence
19642 bases(100 bases per row)
ATTCACATCCTTCTTCTTGAAATCCATCAATCATAAGGTACTTGGCTCCACTAAATAATTGTGATGTGTATTTAAATCGGTCTGTCGTACACTGTTGAGC
GTAATAATACGACGAGTTATTGATCTCAATCGCGTTACATGTACCGCTTGGTGTACATGTTGTATTCATGACTTCAAGTGTCACGACTAAGGGAATGGAC
TCACAATTCGCGTCCGAGTATATTTCAACCGTGGAATAGTCGGCAAAGATTGTCATGAACCAGTTTGATGCGTTAAAGATGGTCAAGACCACGAGCCACG
ACACACGTCGCATGAAGAACTTGAGTCTTTATTCGTATCTCGTTTGTATTAAAGAAAAGCTTCTCGAGAACGAGACTGACGCCGTCAGTTTGGTCTTCCA
AGGACTGTCAAGGTAGTGCGGGTCTTAATTGCTCATAGTCCTCCCTTCTATTACACCGTCTGAGCGATTGAGCCTTTCCACCTTGGAGCGAGTCAGATTC
CAGTGTCCCATCTGGTCAAACTTGTGCTCTTATGATTTGCTTCTCATCCATGTACAGTAGTCTTACAATAGTATTGAATCCAAAGTTGTCGAGTGTATAG
AGAGCGAGAATTCGCATAAGATCTAAAGAGTAGCAACTTAATCACATGGACATGTTTTTCATTCTCGTTCTATTGAAATCAAGAGTTCGAGAACCTTAAG
ACTTGACAATAAAACGATGATACGAGGCACGACGGATATATATCTACCGTCGACACAGGGTGAGTCGGGACTGTCGTGCGAAGATCGATCTAGCAACTGG
TAGAGTTGCGAACAACTGGTAGAGCAACTGCTGAGAAGAAACTAATTCAATCCGTATCAGCAAACACTTGCACTGTATAGCTTGTGGCTATCATACATAA
GACATATTTGAACTGCATATATTGTTACACATGATACATGGCGTTGGAAGATACCAGTTCATGCACCTGCTTTAAATATCAGAAGGGACTTTCTGGTCCA
TCGAAACGTCGCTCAAGGGCTCTAAGGCGTATGGAAGAAATGTGGGACACGATCGAGTGGCTCTCTTAAATACTCATACGCAACCATCTGATTGATTACC
TAAAACATCATGGACATTATGGTGTTTAAAGGAGTGAGCTCCATTCCATCCAATCTTCATCGTTCATATCCACACACCAGTAGGAACATGAAAATTGTGT
GGCTGAGAAAAGATCCAATGTAAAGGACATTGTCCCCCGCCAAATTGTACTTCGCCAATTTGCAGACGATAGGACGATCAATAAAAATTCCAAGTCTTTG
TTAAGTGGAAGGGATTCAGTATTATTATCTTGCTGATGCTGCAGTATATTCACCAATCTAGCACTTCAAGACGCTTTTGAGCTATCGAAGaaaatcattt
tcatcacgCTGAACTTTATCTTCGCGGCATGAACTCAATGATTTGAGAGATTGATAGAATTGAATCAAAGACATCAAAAGTAGTAGCAAGATTTGAAAAG
AAGCAAATTGTTACACCTCGTCtttcttgaggaagcgtcagAGGAGTGCCATTTTTAAGTGAATGGCTGTTGAAGTTTTGCATGACGACGTACCGATTTA
CCTGAACCAAGCTGAAGGCTTTGCGCTATTGTTTGGGTCCACAAAGAGCCAGAGGTGATAAGGACAATAATTGGCGATGTCAAGCATTGATATGCGCCGA
TTCGTAGTCACGAATTGTTGTTATGAATCTTACGTCGTGTGATTCTCTTTGTAATCTCACGATGTAGCCATTATCGTACCtcttttgaattcaaaagtaA
CTTCGAAATGTAGTAGGTGAAAACAAAGCGGAAGGTTAAACTTATTGCTTGTGAAGATCGCAGTGATGGGATGACTTGAATAAGCATCGTGCTTCGAGGT
ACAAGATATGAAGAAAAACATTACTGTCTCTGTTTCCATCCAATCCTATCGAATAgcttgctcgtccactttcttCATAAAAGATGCTTATGTCCGCCTA
GCACAAGCAAACGATCTTCGTTGGGATGGCTATGTTGGTTTCGTGTTGTTACTGTCACTGGCTAGCTGATGAGCTGTACGTAAAAGGTTTAGTGGGGACC
GAAACTACTCAAAGTCGCAGGGTCACGTGGCTGCCGAATGTCTGAGTTGTAGTGCTACAATGGTCATATCGACGATCACACTTACCTTGATGATTTCTTT
CGAGCGTAATAGTTTTTTACCATGAGGTAGATGAGATATCCGCAGACCTCATCAAGATATTCTGATACTTTCCATTCCGATATTTGACCTCGATACGTTT
AGTATTACGAGATCAAATAATGGTTGGTTGCTATAGGTCGCTCATGAGAATAGGACAAACTCCGTCGTTGCGTGACTGGATTTCTGGACCTGTCCAAGGC
ACGGATGTCGCCTTCTCAATTCATATGAATTTCACCACAAAACTGACTCTCTTTATTTGAGGAACGTCAATTTTAAAAGTCCATGCCTTGTATTGACTAA
GCTAAAAGCAGCAATCGTTTAAGGCGGAGATTCTATCAGCATGTTCAAGTAGATTGTGATAGAGAATCACAGTGACCAACCTGTCTTTCCGTCCCTGGGA
GTAACTGCAATTGGCCATATCATTCATGAGGTGATAAGTCGATGAAAAAGTCGTGACTCATTGACGATCTGCAATTTGATAAAGCAGACAGGCTTGACGA
TGAAGCTTACGCGTTGCATCCTTTATAGACACACTGATAGGAATAACATGTCCGTACATTGTGACGCCATCGAAAGGTCTGAGAAACTGATCAAAATATA
TTCGTAACTTCTCAATGAGCAAGGAACGAGTTTTAAAAATACACTAGATAGTGAAGCGAGCTACAGCTCATATGTCGCAATAAAGCTGACATGTCTGCTA
AGGTCTTGATCACTACATCCGccaatttttaaaaatcaAATCAGTGAACTAACACGTTCACTATATGCCAAATCATTTCGTTTATCACGACTAATGTAGC
AATGTGATAAGTTTTCGGCAAGCACCTACATTGTCATCTGTGTCAAATAGAGGAATAGGCGCATATGAACACATTGATAAATTCTAGAATAACATATGCA
CGATTGCTGTGCATGTGTGGATTTCTCAGATCTGAATGCAATGGCCGAGTGTCTATGACTTTTCGCTGTTCTATTGCTACAGAAATCTCGAGCAACGTTC
AATCGATGATTATCGCGAACGTTTAGGCCCTTACGTGCTTAGTCGAGCTGACTGGCTCTTTAGGATGCACATGTGTTACTTCGTTGAATGTTCGATACTT
TGAAATCGAACAAAGTCTGATTTTATGAAGATTTCGCGTACTTCACGTAATTGTTTTATGAGTGACCTGATAAAGAAATGTACATCCCGAAGCAATTGAG
GCCACACATTTATGATATCCTAGATTTGAGCTACTATGCAGTTGTCGGCGTGCGAAGCTTCTATCCTACTAACGTATCACCATGATGAGAAAACATTTAC
TTACGATCGTATTTTTCGAATGAGCAATCGCTCAAAGTGAAGCCTGTAAGAGCTCCAAGTGCATATAAGAGCAGCAATCTGCAATTCTAATCAATGTTTT
GTTTATATTTCCTTTCTCAGATTCTGCAAGATTTATAATTCCACCTCAAGCTGCTTATTGCGTGACTGAGTTATATACGCCAAATCCGTCATGTAAGACC
CTTATGCCACATCGCTAACAGGGAGCCGGAGTTTAGCATATTGAAACGCTGCACAAACCTCTTTCCATCAGCAAACCGAAGGTCAACTCCGATACCAGTC
CTTGTAGTAACATCAAACAATCATTGAGTTCGAACCAAACATCTTTTCGTATGCAATCATAATTCATCACGAGCACATCACGCAATTAGTATGGTCTCCC
TACTACAGATGGAAATACTTTCGCTGTCAGATCCACAGAAAAATCATAAGTTATCCCTGTCCAATTATATTATCGGTGGAATAGTGGCTACTCATCTCAT
TGCACAGATAAGTATACCTGCCGTGCACAATACGGCTTCGTTCCATCCCTATATTCATTGCTCTGATCCTTATCGTGAATGATAAACATATCTAGAGACC
GAATTGTAGTGATCGTAACAATGGCATTTAAAAAAGGAGCCTACGCGCATTCGTGCATATATATACTTTTAAAATCACGAGGGCGCTTTCTAAGTAAACA
AAGCTTTGTTATCGTTAAAGATCACACATTCTCGAGGCGGTCAATTTgaacgccaatgcagatagGACAGAATGTAGTGTCGCCAATTTTCGTGCAAGTT
GCGAGAACAGTGTGTAGCAATGTCTCCTTCCCTGCAAACATATCACTTCGCACTGTTCCTGCAAAgcggttgccgtgcaccttgcataGAGGAAGCATTT
TTCAAACAACTCTCGTTGACTAATGCGCAAATGTAATGTCACCCACGAGCGGAATCGAGAGCATTGAGTCTCCAGGTTGCTGCAGTTGCATCAGTATACA
AAATTAATTTTATTCCGACTCATACAAAATCTATGCGTCAACTTCATCTCATGGTTAAACTCTTTCTATCGCTTGACGTTTCACTTATAGCACACGCCTC
TTCTGAACGGAGTTcgatcatcttcataaaaggcacttgtgggtattcacaattacatACAATTGTAGCAAAATCGAAAGACGTGGGTACACAGTGGTGC
ACTAAGATGCAATAAACCGGTGACCCCAATGTGATGAGGTCACCCGTTTAAAACATTGTTCACGTGTCTACGAGCACTGCGCCTGAAGTCGAGCTCCACC
CTTTGCACTTTTCCGTGCCTGTTTTTCAGACTTCCGCACACTGAAAAAGATCTTTGTGGTCGTCGCACTAAAAAAATGGTAAGGATGGAGGGTAGTTTCC
CGAAAAGAAGATTGCAGTGACTCGCCGAATCTTGACCAGTCAACTCCGCCCTCACTTGACTACACTCGGCCAGGATGTTTACAGAGGCTCTATGCTCAGC
CTCCCCCGTGTGCGAGCTCCGCAACATTATTTGATGGCTTGAAGTGTTGTGACACCCTACCATAGAGCTCATATGATGACTTAATCGTCGCCAACGAGCT
TACCCTGGCTCAAGGATTCCAGCGTGCTATACCGTAAGTGTAAGAGTCACGCCAACTCATTATACCACCATAAGCTAGCTGGGTTGATCGCCGAACTAGG
GCGTAGCCCATCCGTAGCCCTTCTGTTCACACCAAGTACTGAATGCGCACCAGAATGTATTTTCGCGAGCGGTTTTCTTTCCCAGAGATGATTGAATATT
TAGAAGTGCCGCCGGTGCTTAGAGTAGCAGCGGATGATGAAAACCGTATCCTTCATGAGAGATAAACCTTGTAGCTTGAAGCTGGCGAGTGTGCTAATGA
AAATTAACCTCAGTTTGCGCACTGAGTGAAGAGAACGCGTCGTCTCAATctaaaagcttttcaaagaGGTGGACGTCCATCTAGAGCGTTGCCTTATTTT
TGACTTAGCGAAGCACGATGCACGGCGCAGACGTCGAGGTGAAAGCCCATCCCGTCCATGTTGCTTGCAGCCCCGCTCGTCTCCATGAGACAGCTGTGAA
AGCAACTTAGTAAAAACTCAAACACCGCGAGGTCAATCCCATCTCCCTCAAGGTAAATGCACTGTGACGGGTGACCCTGGCAGAAAGGTATGGGCGATAA
TACACCCGGTCGTCGTCAGCGGTCACATGTAGTTTTACCGAACTGGGGTCTCAGACACTCCATGAGCTTTCTAAATGAAGACTACTCCTTCACTTTACCA
GACTGGAAAGCTGCCGTGGCGCACCCGCCAGTCCGCCAAACGTTCACGGGAAGGTTGTTTACCCCTTGTTCATACATCAGTGCTGTCAAAGATGGCGGGG
GTTGAATCTCCAGTAGATGGTCATACCCAGCGTTAGTGACACGTCAACTCTCCCCAAGAGTATCAGCGTATGTAAGAGGACGCTTGTTCACAAAGagtcc
ctcaaacacaacacacacgcttgtgcgacgaggaagcaatTCTtgacgtggagggagaaggacagtcccgacttggaggggagaagaacgacttaagCCT
TTTAGAGCAAATTTGCAGCTTAATTAAATGAATTATGattcctagctacatgcaaaacaccccaagggctcctCGAGGTCTTAATAATGAAACCTTAGGT
TCTTGACTGATAACTCAAGGCTGTACTGAGTTGGAACCTCAGATCTGTACTGTAGCTTGTAGAAGTACGCAGTACAGACTTCCAGTAGAAGTGACCACCC
ACATCAAAATATAGAGACgtgtcggtctcgtcaccatcTCAaagtaggaaccagcattctgtatcacacagaatgtatGTGATTTCATATAAGAAGTCAC
GAATGCACTTGAAAttaccatactgtaatcttcttttatgaagtcccacaatgcatacaacAGGTTCATAAATAAATTTTTATGTgatggctaagtgtag
cccgTAAAGCGTGCATCCGAAACTGAGATATGTCAAATCTCGGTAATCACATCTGATATTCGCCATCGCACTGCATTATTTGATGCGCTCCAAACGGCTA
ATTACACGCTACTGCAATAGAGTAGAAGAGAGCCTAGCTACAAGGGGTAGTGCAAGGCTGATTCGTCTACAACAAAGCGCTTCACATCAGACTGAGTTTT
AAAAGCAGAAGTGTGATATGGCACGTTAGACAAAGAATGTTATTGTGTTCTCTTGTGGGGTGTGAAGAGTGTAACAGAAACGTTTTGCTTCGATCGTGAG
CGGTCCGGTGTAGTACGGTTCCAGATAGGCTACATGCATTTTGTGTGCAAGTGGTTTGCTGTATAAAATGATATACTCTGCCTCACTATACATTTGCATG
TGATTTCCTGCCTTTGGCATGTGTCTTTTACATCCTGATTTTCAGCCATAGCGTCCTGCTCCCTCGCAAAACGCTCAATCTCATTTTGATAAACTCACGC
ATTTTTGCTAGGATACGTAGCCGGTATGAATTCAGCAAAAAGAATTTGGCCGACCGCTCCTGATTTACTAAGACTGCAGCTACTTCGTGGTGGTATCGAA
TGTACCGAAAGGAGTACCAAACTATTCAGGTAACATGAAAATGCATATAGTGGAATTGACTGCGCATTTAGCACAAACCATTGACTGAAGGTAACTCGCT
CCATCATTGTGGTCTCTCCACACAAGTACTTTTGTGGAAATTCACCACCACATTATTGAGTCGTTCCGTCCGATAATCAGTGTATTTGCGGAAGCCGCCT
GATGAAATGTTCAATCCGGTGCCGAGCATTTCAACAgtgtttttcaaattttgttgTGCAAGGTGAATCTTTACTCGATACAAATTTTACCGGCAAGCCA
TGGCGGTGAGACCTTACTCAGGAAATATCATGACAACATTATCGGTAGTCACAGTATCGCTGAAAGCTGCAAGATAATCCATCTCGCTAAATTTGTGCAA
AATCATACGCACTTTGTATTACCAAGAAGTAATTTAATGCCTATAGACCGCCAAATATCTGCAGGAACGGCAGGCTCGCCAACAGGGCAGCCGATACGGC
GACCATTCGTCCCATTGACATGTTCGGCTCTCGCATGCATATTGTAGTCCCTTCATACGCCTGGAACAATATGTACTTATGGTCCTCATCATTGGACACC
ATAACGAGCTGAGTTTCGTGTTAACCTACAGCAAGCCTTGAGGAAACGCGTGACGCTGCAAGCGTGCAGCTGCACACTTTGATTTTGCGGTTTTTGGTTT
TCACATCCCTTGCTTCCCAAAACTTTCAGCATTGCAGCATATGTTGCGTCTGACTCTTACACGATACACTCACCTCATCACTTGACGACGTCACAGCTGT
GACAGGCGACAGATCATAGCCGGCGTTACACAAAGGTTTCCGCACCGTAACGGCTTGATTTATACCTCAAAAATATTGGGTAAGAAGGACTACCACTGAT
AATACGATGCGAAAAATGTGGTGGTGACGTTGCTGCGCATAACAATGCATGATCAGTACGCTCTCGACAtggtaatatccatttaCGTGTCGATTAAGTA
GAGAGCGTACCCTCTGCTTCTACTATGGCCGCTTCCGCTATAATACGAGGACTCTGCCAAGCGCTTTCGCTCCGTTCTGGTTGATTCCAATAACTCTCGT
CATTTCGAGGGTGATGTAGAGTCGATGACGCCTAGGGGTTCAACCTCCGACCCTCGCACCAAAAGCATTACTCTTAAGCCACCTTCGAAAAAGACGCGAT
ACATCCAGGTTGAAAATGGCGTTGTGGCAATGACAGTATTGAGGAGCCCTTCGTGGAACGTTGGATGTGTTCTGAATCAGTTTGGCAGGTCAAAAGTGTA
GGCATTCCCATGATATGACACTTCACGGAATGGACCGGTGGAACGAGGTAAAAGCTTCAAGCGCTCCAAACGTGAGACCGCATTGTCGGATGGCTCATAG
TGGTAAGTAGCGCATAATCCTCATCAAAAAATACACTTTGGCTTGGCGACCTCTTCTATCTACGTaatttttttgcagatcttgtgcatttgacatTGCG
TCTCGCAACTGTGTGATAATATTTGCACCACTCATGCAGCGATTTGCCGAGCCCCCCCCACTTACATTGAAGACAACACCCGTCACACAAATCGATGATT
GCGGGTGTCGCAAGCCTTTAATAAAATCGAATAAAGCCAGTGGATGAATGAACCGAGTTATTCGTAGCTAACTGAACTCCATTTTGCAAAACTTTTCCTC
ACAAAAGCTTCTCAACACATCACCGACCACTCGGTTGGTACGTTCTATTTGCCCATCGGTATACAGGTGTACCGCTGTGGGCATATCCACGCCAATGCTA
AGAATTCGGAAcaattctttccaagaatcaCTCGTAATTCGTGTATCATGATCAGAGACGATGGCGCCTGGCAACCCGTGATTGCGAAAATTATGATTAA
TGAACAATTTGGCCGAACTTTTGGCATCGATGTAATTGCTGCACGGAGCGATacaaaccatcttgctgagtctgtcaACAATGATGAGTACGTCATTGTG
TCCATCAGCATTTTTGGGGAAGCCAAAAATAAGGTCGAGACCGACTGACTTCCAGCAGTCACTAGGATCAGGAATATTGTGCAGTGGAACTTGCGTGTGC
CGTACGCTCTTCACGCGCTGATGGAAATCGCATGTCCTTACGCATCGTGCTATCCACTTGTACTTGTATAGCCACCCAAACTGGGTACTGAGATCCTACT
AAGTCATCGCGCCTCGCGCACTACTTGTGGGGAATTACAATCCGTGGTTTGTCATCATGTGCAACTTCATAGTGAAGGAGAATATTCTTATATGCAAAAC
GATGCAACCTTGATTTCAAGCTACCCAAAAGCCTGTCATGAAATTTCAAATTACTCAATGACAGTGCTCTTATGATCATGTCACACTTTTCGTCCTGCAT
ACgctcgacgtatcatatCAAATATATCGCTTTCGATATAGCTAATACAagctagctcataatcaGGATGCTGGAACAAAGCGTCTACCAGCACGTTCAG
CTTCCCTGGCTTGTACGCAACCGTGAAGTTGTGTTCTGCGAATAATGACAATCAGGAGCCATTTGCTGCGACAAGTGAGGTGACTGAATTGAAAGCGCAA
GTCCGAGTAGACGACAGACAACTTCATACACGGGACAGGTTCCATTACAAATGTTGTGTGTACCACATACTCTGTCTGTATGACATTTACTGTCCACCCT
GTATAACTGAATATCCCCTTATAGctctgttgtatcagaactggcGGTACTTATCGGGTTAGGGGGGGACTAAAGCCTATTGGCTATAATAAAAATGTTA
CCTCATATTTCTATCTATCTACATGAGTCAACGCAGCCACTTCATCAAATTTACGTTGGAAAATATGCTCTATACAATCTACCACAACATTGATCATTCG
AGCATCGGCTCACAGGCCATGTATTCCAACAAAGGTATAGAAAGGTATCGGTATCAAATACACACTCGTCCACATTGGCAGACAGCTTATTCAAGTactt
cattttcaaagtgTTTGGTGCGGGGACCCCATTCGTTTCGACTATGCACGATTTGTCGGAATGTTTGCGCATCGCCACGAAGTGGTATATATACCCGCGT
TACCAGACTTGTAAGTCGGAATGTACTCACCAGTTCTGTGGCAAATTACCAGCCCCTTCAAAATCATCCTCTCGTTCTATCACCTCAGATCAGAGAATTT
CGTCGTCTCgttgtcacaccatcttgtgtgacccaccccttcattccaggatacgtgtaacTTAATTATAGTCCATTTCATCACTTGATATTTATCATTC
TGACTGAATAGTCGATGCTGAGTTTAAATTTACTCTCTGTCTCACAAGAGTCACCTTTTTTCTCATGACAAAATTTAACACAGATGCAGTACACTTCTTA
TATCATTGTGACGCTCCCCTTATTGGGTGGCAACTCGCGTTTAATCTCATGCCATTCCTATACAGAAATGTCTTAACAAAAGAAGGTAGACTCTGATAAG
TGTCCGAATCCTCAACTCTGTACTCAGTGATAATTTCACCATGGCAAATGATAATCTTATCCGTACCAGACATCATTTTGGCGACTTCAGCCTATTGCAG
TGTTTGCACATACCTCGTGCTTTAGCTGCGAAAGAGCATCTGCCAGAGGTCAAGAGGGAAGACTTACAACCCCTTAGTCACCCCGTTTACAAGTGAAAAT
TATTTCTCGTCATCAATccgtagctttttgatgCTCCGCATGGTAAACGGTAGAGCTGACTCAGCAATCCCGTTTAATCATTTTACTTGCGGCTTTTCAG
GTGCCCTTCAACTTCACTGATAAAGGCACGTAGTACTACAACACCCAGCCGCTACTGCTCTACACCGGGCCTGGTATTGAAATCAGCAGTTCACAGCTGC
TCTTTACCTTCCACTATGAGGAACAAGAGACATGATCCTTTCCCGCAATCGCAGCTTACTGCTACGTCTGCACCTTGCAATACATATATAGATTTCAATT
CTGGACAATTTTGTACCTCGCACAGATTCTAGTACAGCTTCAAGCCcgcacaatttttttctgctttttggcagaggtgggttcatgactcgacAAAGCT
CTACTAAGAGCGGCATCTAAATGTCTCTGATTTCAAAATGATACAAGGCTCATGTTTTGACAAACGTATCATGACATCGTACCTCGATATCAGGTTAAGG
ACGAGACAATGTTCCACGCTGTTACATccttcaaaatttgcttgaAGGCTATGCATTACTTTCGAATATTATATAACTGTCCCGTCGCAATATGTCTGGT
CGAACATCTTACCACAGTTGGACATCGTCAATATTACGCGTTCTATCCTGACAGTCGTATGTTGTAACGGCGTCACTTGATCTAGCAGGCTTCACATCGC
TGGCGACGTTGATGATAACAACCAGCAACTCTAAACTGTGAGCCCCTATTATCTTAGAGAAGCTCTCGTATTGGACAGGCTCAATTCACCACGACCATCA
CTAGGTACAATAGAAGCCAACTTGATCCTGATAGACCGACCTGCATTTTTAGATCACAAAATATCATCGCTAGGAGTTTCTTGGATGCGAGTCTGACGCT
TTGTACGTCTCAACTGAGAGTAAAGGGGGTATGATAGCGTCTCTAATGCATTCGTTTTCtttgatcatgcgtcgtACAGCAAAAAAGTCGCCTCATCTTC
CATCAAAGATGTGTTTATCAATCTAATGATGATATTACCCCTTTTCTTAGACAGATAAAGCGTGGTAAAGTTCCCCCTTCTACAACGCACAGGTTGCATC
TTTACTTCAGGTGCAGAGCAAAAACCTTTGGATGCCGTTTGCCACCAAGGGTATTCTTCTACTTTCCGAATATATGATTTCAGATTAAATCCATCTTATA
ACTTTGAATGTATACATAATTTTTGCTTGATTTCATAACAAAGTTATCGTAATTGTTTGAGTAGAACTAACATACCACATGTCCCACTAATCTCTCCTTC
GCAGACCTTACATATTTATAAATTCCACTTTGGTTCTTCTGCATATTTATAGTTACACAAAGGTGtaaatttgtacaatttCGCAGAAGTATATAATGTA
AGGTGGTGATGCTGTATATACACAACAATACAGTATATAAATCAAACGCCCTTAACCATAAAATATAGACTACAGAGTTCACGCTTTTTACATCTTTGAG
AAGCACTAATCTAAAGCAAGCGCGGAACAAGCATTTGCAGCGTTCAGAATTTCACTTAACTCTCGCATGTGTAGTGCCTTCTCTGGAAGCACTTAAACAA
AATTTTCAGGAGAAACTGATAAAATCCATAATCCTTGCTACCAATGATCTTCCAGCCATACTAAAAGGGGGAGAAAGTTTTTTTTGGAACTGTTGTGACG
ACTCAACAAGTCCTGACTTTTCATCTCTGTTTTCGCTTACAAAACGTAAACCAGGCTGTTCATCAAGAAATAGGCGGTGTTTATCAACGATCTCGATCTG
GCCGGGACGCTAACAAGATTTCttgcaagcgcaagagtcaCATGACCTCGTCAAGTTAATTACTTTATGATTTATTCAAAGTTGCTTCTTTACACGCCTA
TGGGTCTTTACCCCTATATGAGACAAaacaagaaccaaaaggatgcTGAGCAATCGCTTTCAGAGCGTCTCAGTCTTTGCACTCCAAAAAAAACCTACTC
TCAGTGCGGTGGTGGTTCAAGCTCTCAATGATGATGTACATGGCGAGACCACTTAAGCGTGCCAGGCTCAACCCTTGCACTGCGGAAGTGTGCCCAGAAC
GTTTACATCGATTTTAGCTGAAAGGATGTGCAATAAACTAACGAAAATATTCATGATCGCCTGTAACGGTaattgcccgtccgtgtacacaGACTTCTTA
AGAAAGGCTTAGGTCAACTGacgcctcaccgcgtgttgctcgcttcctgTGGACCGTTGACCTACGTAGAATGAAGGAAAGAAGATGTCACTTCATCATT
ATAGCCAATAGGCTTTTAGCCTACCTAACCTGATAGATACTTCCaattctgatacaacagagTTGAAAGGGGATATATAACTATACACAGGATGTCCAAT
TGATGTCAGACACAAAGTATGTGGTTCACATAACATGTGAAATGGGACAGGCCCTATTACACTGTGAATATGCCCAATTTCTATAAAAATTCTAAAGGTC
TTCTTCCAATTCTTGCTCACGCTCTTTATATTACTCTGTCAAACTCTTGCTAGACTGAAGCCTCACACGCTTTCTCCACATGAGATCTTCGTCACGATCG
AACTTGGATAAACCTCGTCATTCAGTTCGTTTGCGCTATCGTGAGCTTGAACATTACGACGACTATCACGAAGGACGTGGTGGGCCCACCCGAGCGTTTG
ACGCAATCATTAGCTAAATATGTGCTCGATTGATGACGCAAGTAGCGTATTTTCGCACAATCAGGCTGACCACTCGAGCTGGAGGCGAGCGATACTGCGT
GATTTTATCAAACAATGCGTGGGGtaaaatttagatttttgGAAATATCGCCAGCATTCAGTTTTAAAAAATACATCTCATGAAGGGTAATGGTTCACCC
GACTGCCGCTGCTCTAGTACTCCTGTTAATCCATATTGGACCAGAAAGCGCTCGCGGAGAGTTTTTTTACGCTCGGTCTGGAAGTGAGCTCAATTCACAC
ACAATTAAGCATGTGCGGACTCCACTCCTGCGCGGTGTGCGGGTTTGGGTATGAATACAAGCTTTACAGTTATGTACTTTGTGCCAAATATAAAATATTG
CAAACTGTGTCAGTAGCGCTGAAGGTGCTGTAATAGGttgtctggttcaatcaggaagaACCTGCTGCACTTTCTCCTCCATGTTAACTGCAAGTTCTCT
GGATTTGTCGATCAATTTCCGAAGCAATTTCGTtgcaaaatttaaatttgacaTTACAATGCTCTCCTCATTTCTCCAAAAGCTTGGAATACTAAGCTAA
CTATTGTGTTCGTTCTATTCTGCACAAATATCGCATGAATTCATATGGCTATATCCGCATCATGGCGAGAGTGGGAGTCAGTACCTTACACTTCTTACAA
ACTTGATAGTACAATTTTGTGTAATCgtacaaatttgaaaaatacAATATTGCGTGTTTGTACAAGTTTTACCTACGGTATTGTGTCGTTGTGAGTTCAC
AAGTATTGTCACTCAATTTTGATAATACAAATCCAGAGGAAGAGGATTTTGTTCGCGTGAGTTGTTAGGCCCACATCAAGCATTACAGAAAGTTTCTACT
GCTGGATATCAAAACGCCTCTATATTTAGTGTCAATCTAAATAAAATGGTATCATCAAGAATCAAAAGCTTGGAATAACATAGCAACTCATTTCCTATTA
CCTTTTAGACTCTCGGTTCGGCTCTTGATGAAAGCGTTTTGAACACGAAGCCTTCGAGTCAAATATGTGCAAATGCACAGCGAAACCGTCGTACTGCTCA
TAGCAAAAATACGCTGTCGCTTGTACAGGATAAAACACTAGTGTTTTACCTGCGAGCAAAGCCTTCGGTTAAGTTGGCTGACTGCGAGCTGTTATTCTTG
GCATTTAATCAAATCTGACGAGTGATGGCGAAACGGCGAAGAACATATGACAAATGTAGCGATCCATTGCAAAAACATTGTGTGCAATCGATTTTACATA
CAATAACATGCCACCAACACTATACATTTCTCCGTTTATCAAAAGATGTGATTTTGTTGGAGATAACAAGACCGATATTAGTGGGCAATCAGCAGCTAGA
AATAGAAGTGATAGGATTTCAGCTCGTTTTGTTTTGTATTTCGCAAAGTAAAGCACTGAGAGACAATTCTAGCCAGACATTGGTTTGCTAAGGCTGTCAG
AAGTATTTAGCGATGCATTGTTCTCCTCCGTGGGTGTACCCTACTTTGGTTAACACACATCATCCTTCTGATGCAGGGCAAAGTGGAAACACCATAGACT
GCTACAGAAGGTACTTCGTAAAGTTTAGATCGATGGAACACGTGGGCGATAGCACATCACTCACACTTTCTATATTTTAAGACATTGCACAATAGTATTC
ACGGTTCCCGAATTCTCTTCCTGACTTTGCATCACACAATGCCTGCAGCTACGAGCATTATCAAAAGTAATATCCCTAGCGCCAGGTCCCAATATGAAAC
CTCTATTGCCGACGCCCCATAAATCCTGGAAGGCGGACAGTATATTGTCCGTGAAAGCTGTCGCACTGAGTAGGACTAATATCGCTGCTCTCATCAAGAT
ACATACGTCCTCCAAATCCCAAGTACGAACCTCTGCCCTCGCCCAGAGACAGATATGTACACTTTAGGAGCTAGTCAATTTAGCGCGGGTGGGTGTGATG
GGGTCAGTCCTGTTACGCATGTTATATGAGCCACATACTTGCGTGATAAACATTAACTATATATACTGCGTTGGTATATATATGACATTACATTTACGCC
TTGAGTACACCATACACACTTGGCTGGGGTAAAGAGGGCCTGTGTTGTTAGGGTTGTACTGTAACTTTGTGTATTTAGACTTTTCATACATTCGTATCCA
ATCAATACTTTACCCAAGTGTCATAATATATGAATATGATAAGACTCAGTAAGGTAGAAGTCATATTCACACAGGCGGCTAGCTACATGTCAGATTACAA
AGACTTTCTCATATAATCAGTTTGGATAGCATTTATTATGATATAAAGTATTGAAACTACAAAGCTGACAAGTCACTAATTACTTTGTAAAATCTTAGCT
TCTCTACTAGTTAAGACATGTGAATTTAACCTTTATCATTGAAAACGCTCGGATTTTtttgtcaagcttcctctctGCTACGTGCACTGCAATTCCGTTG
AATACGGGCTCTCATGCAAGGTCGCCCGACAGAGCCCATTCGGGGATTGCCTACACACAACTTGCGCAGACAATCCTAACTGTGAAAGAACTGAGGTATA
TTCGACTTCGTGGCGAAAAGTTTTCTTCAATGTAGAGATTCTTTTCTAAAAAAGGTAGGGCTTACAGTCAAGGTCCGTCGGCTATCAGCATCAACGCCCA
AGCTTGATAGAGCCATTTAATGGGTGATAGATTCAAGACCATCGTGCGATTAAAAAGGAAACGCAACTGTTGAGAATATCGGACGACAAAATATCCGCGC
AGCTTGCAACGGGGATACTAGCAAAAATGCCACATGATTTCTTACTCTAACGTGGGGCTTAAAGGAGTTTGATAGCGCGTACCGTTGACTCTTTCTGCAC
CTATACTCGAGATTTGATCGCATCAtaaaaggtcaccgaccttagccaaacttcctctaagcaaaagtgctacggcagctccgctgcatgtAGAGTTCTG
GCTATCTTATCCGTGAGTGGAAGAATAGATCGATATCGGCTATGCCACCTGCTAGTGAGTGTATAAACCGCGCAATCCCACGTATACACGACGCTGTGTT
GGCTCATGCTGACGATGGATGCGAGGAAGACCTGCAGCTTTTGGCTGCTTTGATCGAGTAACATGTACCGCTCAAACACTGCGAGTAGGTACTAGGCATT
GCAGCATCCAAATCGCGGTCTGTTGTACTCAAAATTGATGTATTTGACCAAAAATATGCTGCATGACGTAGAGACTAAGGACTCATTTGCATCCTCTTTG
ACGCGAAATTTGGAGACGTTGGAATACAGCCAGAATATGCCATTTTTATCGCCTATTTTTTGCCAAATTATAATATACAGATGCTAAATAGGACGCATTG
GTGGATGCTTAGAATAAAGAGATTCGCTGTAAAGTGGAGAATGAAGACGCAACTTTGCTTTTTGATAGTGTGGCAGATGCAGTGCGTGGCACGTTGCTCA
TCAACAAGCTTGTACGCGATGAATCCAGTCTGGGATTGTGGAAAAAGATATGTGTTTTTTGTTTATAGTCGTAAATTTATAGGAATTTACGTGCGTTAGC
GTGATATTGCGCGTGGTGGATTATATATGGTGAACCCAAGTTTGATGGATGCTCACGCTCATGAAATTGCACCGCAGTACAGTGAAGCTGATGGCATTTA
CGCAACAACTCAAGAACAAGGATATACCTGAAAAAGGCTCGAGAGCCGACCCGATGGGGATGTAGCGCCATAGAAGCTTAATGCTTACCACAAGACAAAT
CTTGTTATTGATCACTCAATGAAGGGGGAATTGAACACTTGACGCGGAGATCAATGTTATGGAAATGCACTTTGACAAATGGCAGTTGTGATAAAACTCC
AAAATATATCATTCcgattgatgaagaaaacatAATAGTTGACGAGCTTCCGGCGGCACGAAGAGGTTAGCGCCCAACACGATCAGCCTGTTAAGGGTTT
GTTTTCACAATCGAGAAATTCACGCCAGTTGTTTTTATCAGTGGTGTCTGGATGACCACCCGCAGGTATGAACAGATCGCTCTTGACACGATCGTGCGGC
GCACGAATTCCTTCCTGNNNNNNNNNNTGCGTTAACCGTTACCGCCGTACGAAACAGATGCGTTTGATGTAATGAGATATGCTGTGACAAGTCTGGAAGC
GCCTAGAAAACATATGACTCAATATATCAGCTGCTAACAATATCACGAACGTCTGAGTGCGTAAACtgttgccgacgcgtcaaatggatgcgtctgatGT
AATCAGAAATGCTGTCATACGTCTGCAAGCGCTTTAAacgcatgtgacttgatGTTTTAGTTGCTAAAAATTTCACAAACGTCTAAGTGCGTAAACCATT
GCCGACGCATCAAATGGAAGTGTCTGAAATAGtcagaaatgctgtcacatGCTGGAAGCGACACAAACGCatctgacttgatatctcagctgctgacaat
gtgacgaacgtttgagtgcgttaaccgttACCGCCGAACAAAACAAATGCGTTTGATGTAATAAGATATGCTGTGACAAGTCTGGAAGctccacaaacgt
atgtgacttgataNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN