Description :
From Genome Similarity Track
Location :
scaffold_466:2809- 4514
Transcript NameFunction/comments
Pl_104625myosin-like protein

Sequence
1705 bases(100 bases per row)
GCAATCAGAGTATCCTTGTGAGTGGAGAATCCGGTGCCGGAAAAACCGAGACTACCAAAATTCTTATGGACAATCTTGCCACCATTGCCCCGGCGCCGAC
CAAAACTGCAAGTGAACAGGAAGATAATATCACCACTCGTATTATTGAGGTGAATCCGCTGCTCGAGAGTTTCGGTAATGCCAAGACTACTCGCAACGAC
AATTCAAGTCGCTTCGGCAAGTTCACACAGCTTCAGTTTGACAAGAACCATGCACTGTGTGGTGCTCAGTGCGAGACATATTTGCTAGAGAAGACACGTG
TTATTTCTCATGAACGCGGTGAGCGCAACTACCACATTTTCTATCAGCTACTGCATGGTCCTTCAGAAGAAGAGCGTGACGCGTTGGGACTGGGAGCAGA
AGCACCAAGGTTTGCCTACCTCGAAGAAAAGAAACCCCAGCAAGAAAATCGCCCAGGCCGAAAGTCGAGACCTAGTGCTCCACCACCGCCAAAACCGGTG
TCTGTGATTGAAGCTGAGAATGCCAAAGACCGAGCGCTCTTTGCGAAGACAAGGCAAGCTCTCTCACTTCTAGGACTTGGTCCAGCACAACAGAATGATC
TGTTCCAGGTCTTGTCTGGTATTTTACACCTAGGTGAGGCTCAGTTCGTGGCAAAGCCCGATAATGACGAAGCTTGTGACCTGGATAAGGACTCAGTAAC
CTATTCGAGCATGTTGCTTGGCTTGAACCCGGACACCATGGCTAAAGCACTGACTCACCGAACTATGAAAGCTGCTGGAGAAGTTTACCTGGTTCCGCTC
ACGGTGGAGCAGGCTCAATCAGGACGAGATGCACTTGCTAAAGCTATCTACGCCAGCATTTTCGACTGGCTCGTGGCTGGTATCAACGCCAGCCTGGGTG
CCGCTGCACGACTCACTGCGAATACGATCGGTGTGCTGGATATCTTCGGTTTTGAGAGCTTTGAGCACAACTCGTTCGAGCAGCTTTGCATCAACTATGC
CAATGAGAAGCTGCAGCAGAAATTTACTCAGGATGTGTTCAAGGCCGTGCAGGAAGAATATGAACGAGAACAGATCACGTGGGCTCATATCGCTTATGCT
GACAACAGCGAGACACTTGCTCTCATTGAAGGCCGCATGGGTGTGTTGGCTCTGCTGAACGAGGAGATTGTGCGTCCACGAGGTAACGAGGAAGGATTTG
TGAGCAAACTTTCAGGTGCCTACCTTAAGGAGAAGAAACTTATTGAGTTCCCACGGATTTCCAAGACGCAATTCGCCATTCACCACTATGCCGGAACAGT
CAAGTATGAGGCTACGGGGTTCTTGGAGAAGCACAAGGATGCCCTGCTTTTGGACTTGTCGGATTTGATGTGTGGCAGTCAAGAGCCATTCCCTAAGATG
CTTTTCATGGTGAAGGCTGAGATGGAAGCTGAGGTCGCTGCCAGCTTGAAGCGTTCGACTTCAGGAAGTCGAAAACTTGGAGGAGGTGGCGCTGGAGCGG
ACAAGACAGTCGGCATGCAATTCAAGCAATCCCTGAATTCGCTCATGACCAACATCAACGACACGAACGTCAACTACATTCGGTGTATCAAACCGAATAG
TGTCAAGAGCTCCACACTACTCGAAGACAAGATGGTTGCCAATCAACTGCGCTGCGCTGGTGTCATTGAAGCTATTTGCATTGCTCGTGCTGGTTATCCG
AACCG