Description :
From Genome Similarity Track
Location :
scaffold_25:28080- 29081
Transcript NameFunction/comments
Plaha_PHALS_13633voltage-gated ion channel superfamily

Sequence
1001 bases(100 bases per row)
AAATCTGTAATATTTCCTGATGATCTGTATTGCACAGCTAGCACTTTAGACAACGTGGCAATCTTTTTTAATGTCCGCTTTGGCTGAAGACGAGGCATCG
CCAGATCTGCGCTTGAATTTTTCCAACTTAAACTCCTTCTGCTCTGACTTGGCTTAAGTGTTGCGTCTGTATTGGCCTGTAACAACTTATTTGAAACATC
TGCTGCGGCCAGCAATGCATTGGTATGATGAGCGATTGATGGCAATGGCTTTGGTGCTCTCTTCGACCCATAGCAGCGTTCAATCATGGCTGAAAAATTC
AAACATGCCGCCTGACATCCGTTAAAGTCAGTAACTTTTTCTTTAAAAACGATTGACTTACTTACCAAACAAAAGTCTAGATTGACTAATATCTTGGTCT
TTATCACTTCTTCTCGTTGTCTCGACAGTGTCAAATCGTCACTGGCTTGTTTCTTTATCAAGTTGAATTGCTCATTCCTTAGCTGAATTAAAATACTGAT
GTCATCAATCATTTCGTGAAAAACTTTCTGCATGAGGAAAAATTGTTGAataatttcttcttcagTCAGTCGTGTGTTACGTTGTGTAGCGATgacttct
tcatcttgaacggTATTCAAGGGACAAACAGTGGAGTTAGATCTTGAAAGAGACGTGGTGGATGTTTCAATTGCATTTGAAATGGCTTTTTTAGCTTCAC
TCTCAACTTCAGCAGAATTATCATTGTCAGAGACGCATGGAACGATCTGTACTTTTAAACTTTCCTATTTCGCGTAACATAGAAGTTAAAAATATTGAGT
AGCTTTAGTCTGGATCGACAAGTTCGTACCTTTTTCAGACGCTCTTTTTGCGCGTGGAGTTCATAACAAACGTAAAATTGTCCACCCACGAGAGTCAAGG
GCATTGCAGTATAACATGAACTGAATATCACTCCAATAATGTCGACCAATTTTCCCAGGGATGTACGAGGACGTAAATCTCCGTAACCAACCGTTGTAAA
A