Description :
From Genome Similarity Track
Location :
Scaffold_24:280755- 283447
Transcript NameFunction/comments
Hyaar_Emoy2803941AlNc14C82G5319

Sequence
2692 bases(100 bases per row)
TATGGCTTAAGCTAGCAACGTAAAACACTGGGTGTGTGCGCAGATTGCGCGGAAGATTGAGTGTATAGGCAATACCTTTCTTTGCTATGGCTATGAACGG
CCCGATGAAGGGTGGGCGCAACTTCGTCTTGAAGTCCGAAGACACTATATTTGTAGGTAGGTTTTTAGCATTTAGTAAGATTTAGTATCCAACTTCATAA
GAATCAATACATCATCTGCCCTTAGCATTAGATTTTTCTTTTCGTTTGCTTTGGCTATCAGCCATTGCATCACGCACGTGTCGTAAGACACTAAAGCGCG
TCGCGAGGAACTCGCTCACTTGTTTCTGCATCGTGGTAGTGCTGGTCTCAGCAAGCTTATCAGCGACTCTCCCCCACCAAGCCCGGAACCACGTAGTGGG
AACGTGAGTGGAACGCGGGGGTGCGTGAGGCTGTTCACATAGAAGGGAGTAAAGACAGTCGAGGTATGAACAGCGTTGTTCAACGAAAACTCAATGACAG
GGAGCATCGAGCTCCAAGTCTTGGGCAACTCAGTACAAAAACTGTGAAGAACATCGCCAATGAAGCGATCAATGCGCTCAATTTAACCGTCGGTATGCAG
ATGATCCGCTGTGGACATGTTCAAATAGGGTGCCAAGCCCCTTGAAGATGGAAGTCCAAAACATTTTAGTGAGGCGATGATTGTGATCAGAGATGATTGT
CAGTCGCAACCCATGTAAACGAAACACACTATCGATAAACAGCATAGATGTACCTTTAACATCAATAAAGTCCGGCAGAGGTGCTAAGTGAGCCATTTGA
CGTAAACGATCAAGAGGTACCAAAATCCCCGCAATCCCGTCACATTCTTGGAAATACCAAACACAAAATCTATACTGATGCGACTCCCAACACCTCGTGG
GCACCGGTAAATTGACAAATGGCGCAGCCGAATGTGCCGAGGGTTTTACCCGCTGGCAAGATTCGCATGTACGCACGTATGTGCTCACCCATTTGTAGAG
TTTGGGCCACCAGCAGTGTTGCCTCACAGAGCCATAAGTATTTTCCCAGCCCAAATGCCCACCCAGAGCAATATCATGTGCCTCAAAGGGAATTCGGTAC
TTAACGTTCTCATCGAGAGGCACGACGACGGAAGGCACATCCGTTACATCCGTGCGCTAGTACAGGAGGCCAATTATAATGGCATATCGAAGTAGACTGG
CACGTAGCCGTGCTGAAAAAGAGGAGTCCGAGTCCTTGTATTCCGCACCCCCAAGGGCATGAAACAATGCCACACATTGAGAATCCCGTAGATATGCCGC
ACGAATTAACTCCTCAATAGAAGACGACAAAGTCGTGACATGAGCAAGATTATAATCAGGTCTGCAGGAGAGGTCATCTGCCAACACATTGTGTTTGCCT
GGCTTATACTTCACCTCGAAGTTATATTACGCAAAGAAGGACCGAGCCATTCTCTGAGAGAAGTAAGGCGACTGTGTCGCTGTGAGTAATGACGCATGAT
CCGTATAGACGACAAATGGCTTGAAGCCAAGCAGATGGACTCTAAATTTGACGAGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGAAATAGATAATT
CTTTTCAGCAGCTTTCAGCTGACGAGATTCAAATGCGGTAACTCGCTCGCGGCCTGCATCTGGTTGTAACGGGGTGCTGCCTATAGCAAAATCGGATGCA
TCGCAGACAACACCAAAAGGGTACTCAGGATTTGGCAATGCCAAAATGAGAGCATGGAGGAGACTCTCTTTATTGTCCGAAATGCGTCACCATGGGTGTT
GTCCCAGCGCCAATCTGTGTCCTTCTTAAGGAGATCAGTTAATGGCCGAGCCATATCAGCGTAGTTTTTACTGTATTTGTGTAAGTAATTGACAAGACCA
AGCCACTTATTCAATTCTTTTTGGTTCTTAGGAATCGGCCAGTCCACTTTAGCCTTGAACTTAGCGAGTTCCTCTCTAAGGCCGCGCTTACCAGTGAAAC
ATCCTAGAAAAAAAATCTCCTCTGCACCAAAAATGTATTTAGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGATAATGGCTCGCAAATGACC
GATGTCATTTTCAACATCTGACCGACCTTGTTCGGCACGACTATGGACAAAAATTTCATCAAAGTACGTCTGTGCATAATCCCGATGTGGGCAGAAAAGT
TGCGTCATCAGACGATTGAATGTTGCTGGAGCATTATACAGCCCTTGGGGCATCACCAGCCATTCCCATAGCATACCACTCGGGGTGCTCACTGCTGTCA
GCGAAATATCACTCGCTCGCATGAGCAATGGATAATATCCATCGACCAAGTCGAGTGCTCTATACATAGTGCAACCAACCATGTTGTTTTGAAGAACATC
TATTCAAGGAATGGGTGTCTGTGCTGGAATAGTAACCACATTAAGCTTGTTATAAGCATGCACAATACGCCACTTGCCGTTCGGACTTTGACTCAAAAAG
TCGGTGTCGAATGTGGAGATTTACTCTCACGTACCATTCCTGCCTCGTGCTTGGCACGGAAGAAGTCATCAATGACATCACATTGCTCCTTAGGCAAGGG
CCACAGTCGTGTGACACAGTATTTGGTCTCAGGAACCAAGTCAATTTCATGACGGACACCTCTACCAGGAGGTAGAACAGAGGGTGAGTCGT