Description :
From Genome Similarity Track
Location :
contig_47:280656- 295118
Transcript NameFunction/comments
g9235.t1RAW26828.1 hypothetical protein PC110_g16773 [Phytophthora cactorum
g9236.t1hypothetical protein
g9237.t1hypothetical protein
g9238.t1POM70904.1 Zinc (Zn2)-Iron (Fe2) Permease (ZIP) Family [Phytophthora palmivora var. palmivora
g9239.t1hypothetical protein

Sequence
14462 bases(100 bases per row)
TTAAAATAAGCACCGGAATGGCAGCCTTGCGTGCAAAATTGCTGATCCGCCTGCGATGCTGCAGACCACCACTATATTTACCATGGACGCCAGCGGCACC
TCCCACCTGTGAGGCGATTTTTAGAGATGGAAACCTCCAGAACTGCGGTCTATCTCCGGACATGGTTCTTGTCCGACAACTTGGCTTGCAGAAGTAGTAG
ATGGCTCGTCGGTTGATGTCCGTTTCCTGAGCTCATTCTTGATTCGGCTTGAGCGAGTGCGCGAGGAAGAACAGACTGAGACCAAGCGACTGGCAGCATG
CGCTATCGGGAGGGACTCGCATTGCTCCTGAGCACGACGATGGGGTGGAGCCCGGTGCTTGGAGCAGCCACGTGGCCGTCCACCTGCTCGGATTCAGCGA
TGTCAGTGTGGCAAGCCACGTGTCCCGCGCGCACGGCGAACAACACCAACTATGTGTCGCCAACCGGCATGACTTCCGCTGAGATCAACGCCGACGAGGC
GAATGCCCTTGTAGCGTACAAGACGGCACGTCAGAGTGCTCTCAAGTTGAGCGCTGTTGCAGGAAATTCTGCAATGTCGGGAATGCGCCAGAAGAGCGAG
AGCTGGTACAAGAAATCGTTGGCGAGCTTTACCACCTACATCTGCGTCCAGTCCTCGACCGACGCAGAGCTGGAGCGCTGCGTGGACCCCTCAAGCAGTG
ATGCTATGCGCGACATCAATGGCAAATGCGTTGTCATGCTAGACGCTGACTCCTGCAACAGCAAGGACAAGTGCGAGCGCAGGAGCAATTGCAAGTGGGA
CGACGTCGTTCCTAATGGAAAGGAAGCCCGCCGTCAGATCTTCACGGACGCTGATGTTACTGCTGCGACCAAGTGGATGTCAACGGGGTACCCTAGTTCC
TTGGCCCCTTTTGTGGCTCCTGGCACCGTCATGGGTGTGCTTACAGCGTTGAGCTGCATTGGCTTCGTAGTGCTCCGATGCGTATTCAACCGCTGTGGTG
GTCGTGAGCCCAACGAGAAAGGCTACTCGCGCTGTGACGTCCTCGTCCCGACGCTCACTTTCTTGATCTGTTCGCTGGCAGTCTTCATCTGCATGGTCAT
CACAGCAGCACTCAATACAAGCATCTCGGATGGCGTTGAAGATGTTCTGTACTCGCTAAAGGCTACCTTAGAGAACGCCAACATCTTTGTGGCCAATTTG
CTGACGCCCCTGAACGACGCCACCGCTGAACTTACTGTAGCGTCGAAGGCGGTGAACGCTCAGCTGAAGAACTCGGACTGGATCGTGAATGACGGCGCCA
CGCTCAGGCAGATGATTGCGGATTTCGGTAGCATCTATTACAACCACGGCACATTCCCGACCCTGACCTGCGATCCTGCGACGAGCGAGACATTCTGCAT
GGCATGCCCCGACCGAGTTTGCGGCTCCCCCGTCACGTTCTTCGTCAACAACACCGCAGCCGCAATCACGGCAAGCAGCGACATTGTAGGAGACGCGGTG
GGCTTGCTTCTAAGCTCACTTGTGAACGGAAGCGCTGCACTCGACACGACTCTGCGTACGGCGAAACGGGATATTGCGGTTTTGGGCGCAGCTACAAACA
GCTCCATGGATGTCGTGGGCGTGCTTACCAGTACTTTCAACGACCTATCATTCTCGCGCAGCGCACTCGTGGTGTGCGTGTTCCTGTTCGGCATGATCTC
GTCGATCCTGGGGATCATTGCCATCGTAAAGAACGCCTGCACTGCTAAGACGACCCAATGGGTGCATCTGCTTCACGTAAGCTGGGCGCTGGGTGTGCTT
GTGTGCGTGTTAAGCTTTGTGCTTTCGGCATCCCTCCTTGCAGTCGGAGCTGTGTGGTATGACTCGTGCGAGTACATGAAGCTACTCCACGAGGACATGT
CCCCGTACGCATCGACGCAGCTATCTGCGATGGCGAATGCTTGCTTCAACGGCAGTAATGTGCTCACACCGCTTGGTCTCGATGCTCCTCTGACCTTCTC
CTGCAATGTGGAAGACGAGTATAAGGTCGTGAAGACAGCGGACACCACGAGCGTCGGAACAGTCATCTCGAAGTACGGCGAGATCGTGTCCAACTTCGAC
CTCACCGATTTTAACTTCAACTCGACGCGCTCGAGGAACTTCGTGTCCAAGCTTGCCACTGCAGCTGAGGCCGCGAAAAAGAAGCCGGCCGTGAAATTCA
CACAGGAAAACATCCTGACTCCCTGGTTGGCATACAACGAGCTGGCCACATCGTACGGCTGTGTCAACAAGACCACGGAGGAGCTCCCTGTGTGCTACAT
GACGGGTCTGTGCGAGTCCGACACGTCGGCCAAGACGACAACGCAAGCCGCTTGCCAGCTTGCATTCTACGAGGCGTACGAGTACATGTTGGCCTTCGAC
AAGGCGAGCACGATGCTGGACGAGATGCGCGAGACTCTTCTGGGAGACACGGGCAAAACCTTCCCAGACCAGTGGAATTACTCCATGTCAATCTCCGAGT
TCGCCACTACGTACTTCACCAAGATTACTGCTCTGAAGACCGGCCCGCTGCTGACGATGCTGGGGGAGAAGGGAACGGTGCGCAGCCTCATGACGTCCGT
GGAGCGGGCACGCTGCTCGGGCGACTGCGCGTGGGCCAACCTGTCCTTCGACGCCATCAACGAGTCGCTCTGTCAGAACGTGCTGGGCACGACACTGGCC
ATCTCGTTGTGCGCGCTGTTCCTGAGTCTGTTCCTGCTGCCGCTCATCCTCTCAGCAATCCTCCTGCAGAAGCGTCTGCGCGGCGTGGCCAAGGGCACGT
ACGACCAGCTGGAGTTGCGTTTGCAGGAGCTGGAGCGCCGCGCCAAGCAGCAGAAGCAGGAGTCCGAGGGTCTGTCACCCAACGGCGAAAGCTCCAAGCC
CACGAGCGGCCTCAGTGCGCTCGGCGGGCTCTTCAAGGGCAAGAAGGTGCAGCAGCCGACGGGCTCTCCGTAACGCGGTTTATTAGCCTCCTTTTCTATA
AGCCAGCGCCGTGCTTGCTCAACGGAAGGTGAGCACACCAGCGCAGGACCTCGACTATTAAAATACAAGTAGCATTTGCATAAGTCAGCAGTTTGCCATT
TGCGAAAAAGTATCTTGCCTCTTCAACTTGCTCTGGACGCTGTTTCAGCCAATCAAAATCGATGCAGTTCTATGTTGAACCGCTGCATTTCTACCAACCA
GTGGCCAGTTCCAGTTCAGTATCACATTTCCACAGGTCATCGATGGCAGCTCGCGACGTAGTGGTGCTGGGTGGGGGCATCTCGGGCCTGACGCTGGCCT
ACTTCCTGCGCCAGGCGCTGCCCAAGGCCGCAGCCGATGCCACGCGTATCCGCGTGCTGGACGCCGGCCCCGTCCCTGGCGGGTGGGTACACACGGCCAA
GCGCGACGGGTTCCTGTTCGAGGAAGGTCCAAGAGGTTTCCGACCCTCGCGCAATGGCGCCGAGATGCTGAGATTGGTGGAACAGCTGCAGCTGCAGAGT
CGTATGCAGGCCGTGGACCCGGCGGCACACGCGCGATTCATCCTGCGCCACGGGAAGGTGGAGAAGGTGCCTGGATCGCTACTGGAGGCGCTCCGGTGGC
CGCTGTCGCTGCCTGTGGCGCGCGCGGCGCTGCACGAGCTGTTCGTTAAACCAGGGACAGCAGAGGACGAGTCTGTGTACCAGTTTATGGCCAGGAGGTT
CAGTCCCTTAGTGGCTGAACGGCTGCTGGACCCCATGGCGTCGGGAATCTTCGGTGGAGACATCAGGAAGCTCTCGATGCGCTCGTGCTTCGCCATGCTT
GTGGATATGGAGAGGAAGCACGGGTCGGTGGTCAAGGGGATGCTGTTTGGTGGCACTGGCGACGACACGCTGCTGGATGGCACCAACAAGTCGGACTTTG
TCAAGAAGCATGAGAAATCGGTCAGTGTGAGCTTCACGGACGGCATGAGTACACTGATGGATGCACTGGCAGACAGTATTGAGAACGACCCGATGGCGGA
GCTGCAGCTGAACACGAAGGTGACGAGACTAGCGGTCCACGGTCTCGACAACGCATCGTCAAAGGCCCCCAGCTTCGTGGTGGAGAGCAAGGATCCCACG
TCCGGGGAGTATCGGGAGCCGATTAAGGCCTCGCACGTGTTTTCGACCATCCCGGCATGCTATTTAGCCCCGGCTGTGAAGGACACGGCGCCTGGATTGG
CAGAAGCGTTGAGCGAGATCAAGTTTGTAGACATGGGCATGGTGCACGTCGGATACAACGACAAGGTGCTGTCTACCGAGGGCTTTGGGTATCTGATCCC
AACTGCAGAGCGTGAAAAAATACTTGGTGTTGTGTTCGACTCCAACACTTTCCCTGTGCAGAACGCTGAAGGCAAGACGCAGACGCGACTGAGTGTCATG
AGCGGTGGCGCGCACTTCCGTGAAGTGGCGTCGCTGCCGGAAGGAGAACTGGAGCGCAATGCCCTGGATGCCCTCAATAGACATCTCGGTATCACGTGTG
AGCCTGACTACGTGCGTGCTATGACGATTAAGAACGGAATCCCGCAGTACCACGTGGGCTTTGCTCAGACGTTGCAGCGTATTGAGAAGCAGGCGGCGCG
CAGCGCACCGGGTCTGTTTCTGGGTGGCAACAGCTTCTACGGCATTGGTCTCGCTGACTGCGTGACCCACTCCAAGCAGCTCGCGCTCAAGTTTGCCAAG
ATCGCGTCGTCTTGAGAGAATAGAGCTACGAGGCAGTTGGTGCATGTGCACATTTTGGTGCCTGAAGAGTGCGTGCGTAGTGTGCGATGGTGCGTGAAGT
ATCTTCCACACTGCAGTGAAAATGGGCAAATTGCTACCGTTCTCTTTCGTGCCGGTTTTCGAGTTCTTCGTATTTATTTGGGCGGGCGTGTTGTGCAGAA
ACGGCTTTTCGGGAGCGACTTCTTCAGCTCGTCGATCTTTCGGAGCTGTTGCGTGCTGCAGCCAATATGTCGCGGACTGCGCCATCTCGAGCGCTTGATC
CTGTCTACGGTAGGCTTGGCGTCTTCGTTGTGGACATCTCGTGGGTCGCCTTACAAACTGTTCACTGTCCGCTGCAGATACGGTGTACACGGTCTCCAAT
TCAGGCGGCTCATTCCGCAAGGGTGTCTACCGAGCATCTTCGAAGCCTGCTAGCACTGTGAGCTCCATCGGTAACCAGAACCCGGCGGAGGGTAATGAAC
TCGTAAGCGGCAGCCAGCGGGTCAAGTTCCATCGGAGACCAGTGCTGCCGCACCTGCAAACGGAGCCACCGGAAGTTTTACTTGCTCCGGTATATGCCGC
CTCGGCACCGCCAGTCAAGCATCGAGATACGAAATTGTCAACACCCTCCCATGTTGCTGCCGATGTAGTTAATGGAAATACTCGGTCAGTGGGTATCCAG
ACTGTTTATCGCGAGTCGGAGGCGCAGACAGACCCGTACACACCAGACTACACCGTTCAAAAGACAGCTACTGGTTTAGCACCCGAGATCGCCACGCTTG
CGGGGCTAAGCCATGCACGTGGTCAACTACCAGTTGGGCAGGCGGAGCTGGAACTTATGGAGCGCAACCGCAAGAAGAGAGCTTTCGAGGCGTCGCTTCC
CCCCATGACCGACGAAGCGAGCTTTCTGTTGCGCAAGGCAATGCTGGAAGCACAAGAAACCGTGAATGGGCATTCCGCGAGGCGGAGATCGATGCTTTCC
ACGATCAGCGTGTTGTACTACTTGAGCAAGCACTTGCGGAGCGCGAGAAAGAGACCGCATTTCTTTCGGAGCAACGGCTTGAAGCGCTTCGTCAGCGGCT
GCTACATGAAAAAGAAAATGCGCTTGAAAGTATTCAACAAGAACGCGTGACAGCTCTGCGAAAGTTGACGAAGAAACGAGCTCAGAGACAGCAAGAGCGC
GGGTTTGGCGCATCACGTCCGGAGAGAGGCCGCGACATCATTGCCGAGTACGCGAACTTCGGCTCGCAAGTATATGCCCCTGTCACCCGAGATGGGAAGG
CTGGCAAAATCGAGGTTCGTGAATTGGGCATCGGGAAGGCGCAGTTTTTGCAGCTTGATGCTTTACGCGAGCTTGAGAGTGCTTTACCTGCGCGGATGTT
ACTTCCTGCTGCTGGCAAGTACAAACCCCGTGAGAAGAGTGGCCACACTGCCAAGGAAAGGAAGCAAGCAGCTATAGAAGCCCACCTCCTGAAGATGGAA
TCGATCATCAAGAAAAACAAGGAACAGAAGGAAAGTACCAGTGCGGGTGATACTACCCCTGGAGCTCATAACAATGCTCGCCTGAATGCTGCTAGCCCGC
TTTCACGACGAGCGAGTCAGAGACAACCACTAGTACGTCCACCCACACCTGACTACGCAGCGGGTCATACGGCCGATTCGCAAGAGAACGAAGTGGAGGA
TGCAGTACGCTTACTGCAGAAATTGCTGCGCGGCCGTGCTGTCCAAAATATGATGTTCGAGGGTAAGGAGAGGCGTGCCGAGCTCATTGCAGAGCTGCGT
GCAGCCGACGAGCAACTAGCTCTGCAGCACCGCCATGAATTCGCACTCGCGCAAGGTTCTGGCAACGAGGCAATCGACCGTGTTGCAGACGCAGCAAAAA
CCCGCGTGGAGGGCGAAGTGGTTTCTGAAATGCTCGACTTCTTGTCGAAAGAGCTCTATCGATCTCGTGAGGTGGCTAAAATGCGTGCTTTCGTGACCAA
GGCAGCTGAACAGCGTCACGTGCGCGAGGTAGAGGAAGGCGGGCGACGACAAGCTGAAGACCTCTTACGTGAACGGGAAGATGAAGTATTCCGACGGGTT
ATGCAGGTGCATCAAGAAACATCCGCGACTTCGTTGACGACATGCTGGAGGATGTAGCTCTGGAACAATCTCATTCCCAAGCGCTGCAGGAGCTACACGT
ACGCAGCGCTGGTGTCGATGGACTGGTGCTTCAGCTGGAGAGTGAACTGGACAGCGATGAAAATATTGTGCGTGAGCTAGTGGCAAGCTTCTTGCTACCA
CAAGTCCACAGACAGCACGTACGCCGTCAAGTTACTCAGGAACAGAGAAAATATGTGACGGCAGCCCACGCTTTACTAACAGAGATGGTTACCGGAATGA
GTCAACCGAAACCCAATTCCAGTAGCAACGAGGCAACAGAAGACATTCTTTGACACATGAAGGAATATAAGGCTTATTGAGGCGCTAGCCAACATGGTGA
CTTATCCTTGATGCACAAGCAATAATGTCTTACTCGTTGCGTACTCGGATTTCACAGCTAACGGGTCAATTCACGTGATAGCTACTTGCCGCTCGCACCC
CCGGCAGAAATACCGGTGGTGCCACTTCCTGCAGACTTGAGGAATGCATCGAGATGCTGTCCTTGATACTTGAGAAAGTCTAGCTCCTCTTTGAACTTCT
TCTCCTGCAAAGCTTTGCGCTCGGCCGCTCGTTTCTCAATAACCTCGAGTTTGTTGGTTAGCTCCGCCACTTTGCTTTCGCTCTCGTCCTTGTCACGCTG
AAGGCTGGCGATCTGCTCTGCCAGGTCACCCATGCCGTCTTCGGCCTGCAATTGTTTTCGGACGCCAAAGGTCAAACTCGAGTCGTACAGTGTCTTGTAG
GCATCCGTAGTGAGTCGAAGCTCATCACGAACGCGTAGAAGCAACAGTCCTCGCTCGGGGCAGTTGAGTGTCACCTCACGAATAAGCTCATCGAAAGCTT
GCGAGTACAGATCCTCCCGGACGGGACAAATACCGCTTTCACGGGCTTGTCGCTGTAGTAGCTTGGCATCAAGTGCCTCCTGCAATTTCAGCACATCGAA
GCGAGTCGAGGGCACGCTGGACGCGTACCGAAGCCAGAAACCTGAATTCTCCTCGGACCACATCCTGAAAACAGCAGAAGCGATGGTTTAGCACATGTCA
TTGCAAGTGATCGGGTGGTGATAACGGTGACGCACTGGGGCGGTAAGACAGCATTTAGGATATCCTCGACCTTTGCAACACCATCGGAGCTTTTGCCATT
AACTGCCCCACTCGACTCCGCGGCTGCTGCCACTACAGTTGCTGCGGTGATGGAATTCGAGGAACCTGCGTTGGCAGCACCCGGCGTCCTCTTCGGTGGG
TCTAGCGTTTCGCCCGTGAAGATCGGCTCGCCATATTGCACGAGGGATTCTGGAGGTGTCGGTGTTGACATCTTGCTCGTACAAATGCTTGGTGTTTCTC
CAATTCACGTCTGCTAGCAAGCGTCGCGTCCGTTCACGAACTCAACTTATCAAGACTCTGCAAACGCACCCCATCGTTATTTGCTTTTCTGCCTACAACT
TCCTAGTGACGCTGGTTAGATTTCGCAGCTACAAGCTCCTGCTTCTCCTGACGCTTGCGCTCCGAGAGTTCTTTGGTTAGCTGCTCTGGGCTCTTGTAAT
TGTCTTTGGCACCAACTTTGCGCAGCCACTTGCTACTGTTGGTCTGTCGTGCTGCCTCCAACGCTGCAAACTTCATCGAACCAACACGAATGAATCAGTA
AAGTTCAAGACAGGATGGCATCATTCTCACGCACGTGCTCTTTGCGAAGAGTCTTGGTGAGCTCGACCGACTGGTTCCAAGCCTTGACGTCACACAGGTC
TGGGTGATTGGGTAGCTCCTCTGTGCACTTAGCAATACCCTGCAAATCAGAGAGCAGGCACGTCAATAATCCTGCGGACACTTAAGACAGTTCCCCAACT
GATAGCCATACTTTCATCACGCGCTCGTCGCCGAAGGCTTCTCCTATGTACTCGTCCTTCAGAGCCACCTCCAGGATGCCAGTGTTGAAGCGGTTTGATT
TAGGCTTCAGTGTTGGATTCTTCTGGGGTAACTTTTCGGCACGGAAGTTGTACGCGAACATGTGGGCACGATTTCTCTACAAACGCCACAGTAAAGTGTA
GCTTCAGGAAGGAGAGGGCGATCCACTCATTTCTCAAAACGAAGCGTACCTCAGCATTAACATTAGTTCTCTTGTAACACTTCCCAGTCATCTGCATGTT
GTCCCAGTTCGAAGTAGAAGTCTCCCATTGTGGGGTCTCCGCCGAAAGAATGCGCGAGCGAAGCATTTCAACGACCTCCAACTTTGCCGCCGCTTTGTCG
GGCGCGGTATCAGCTGGGCAGAATACCCGTTCTTCAAAAGAGTAGTTGATGGGTGCATCCTTTCCACCAATACGCTTTTTCGCATGCATGACAGTAGTGC
TTGATGGAGGACTGCCAGTCGCGAGTGATGAGGTGCGCGTGGTGCTTGCGGCAGATTTCATTGCCTTCTTCTTCTTCGACCACTGAGAGTCCCCGCTTTG
GTCTCTTTGATGCACACGCCCAAACAAACATCGTCGAGAATATAGACCACGCATCATAAGAGACAATGCAGGGATCTATTACCGTCGACAAGTGTGAATC
GATCCGCTATTAATTGATCTGGTCAGTGCATTGAGAACACGTGAGAGCTTGTCTTACCTGCAGATACTCTCCACATCTCAAGCCGACTCGGTTGCAGCAG
CTGAAGCGGTTTGAACTTGCTGGGCCTGCCGGATACTATTGCGCTCGGCTTGAAGGTGGCGACACAAACTCTCGAGCTTCTTAAGCTTCTCCTGCAGCTT
CAGCGTTTCCTCTCCAGTTGTCACCTTCTCCTGGATAGAGGCAATCGCGCCGCTGTCATACGCAGCACACTTTTTCCGAAGAGCAAGGTTCTCCTTCTCC
AGCTTCTTGGTCGTTTTTGCCATTTTGTCCATTTCCTCACGGAATGTCGTGAACATCTGGTTACTTTTTGTCAGTGTCTCCTGCACGACGTCGAACTTTT
CAGAGTAGGAGTTCAGCTGCGCCTGTAGCTGAACCTCGCGATCGGAAAACTCCTTGGCCTTGTCGAGGGTAATCTTAACCTTTTCTGCCTCGCGTGAAGT
CAGCTCTACCTGGTGCTGCAGCTTTGTTTCCGCAAGCTGCACTGTCAGATCCTTAGCCTCGAGCTGCCGCTGGAAGTGCTCTTCTCGAGCAGTATACTGT
TCAAGGAACGTCTTCAGTTTCTGCTGGAGGCTACAAATATCATGCACATCCAGGGTAGGCAAACGTCAGTTAGAGTGTTGCGTCACTGGTTGGGATAAGG
AACTTGGTCACATACTTTTCATTTTCCTTCAATGAGGCCACGTAGTCCTTGCTCTGCTGATCCATTTTCAGGCTCACTTCTTCGATTGTCTTCTGAAACT
GAGCCGACAACTCACGTCTGCAATCCCGACATGGACCAAACACGCAACGGTTAAAAAATAATTCAATAAGAAGTCCCCAGTCACATCGCACCCACCTCTT
CTGGTCCTCTTCATCGGCAATACGACGGCTTTCACTCTGGATACAACAAATGATGGTGAGCTCGTTATAACGCTGGAACAAGAGCTAGAAATCTCCTCAC
CACAATGAGCTTGTTCTGCTTCTGCAGCTCCCTGCAGAGCTGCTCCAGCTTGGTCTTGGACGTATTCGTCTTCAACAGCTCCGTGCTCACTACACAACAT
CCCGAGACTCATCAGCACAGGGAGGTACTTCACGATCTCTTTGCAGCATTCACCTGCGCTCTTGCGTTGCTTCAGCAGAATGCACTTGGCATTCAGCTCG
CCAATCTTTTTCTGCAGCAGACCCAGTTGTTCACCCTGCAAATTCTACACACGTCAGTCTCCACCTCTTCCGCCCCAACAACTGCCTAAACACGCACCGC
CTGGTTGAGACTGTTGACAAGCTCCACCACCTTCTGCTCCGCCGGCATTTCCTTGTCCTCCTTCACAGCCTCCGCCTTCTCCTTGAGCTGCGTCAGCAGC
GTCTCGTCCTGGTAAATTCCTGTCACAAACCGTACTTTTCAGTATTTTATCTCTCGAAACTTGCGCTTTTTCGTCGCACCCGTGAGCTCGATGGGCGCCT
CAAGGTTCTCGTCGCCGCCCACTTCGATCTCCGCGATTTTTCCGGCCAGCAGCTCCCGCAGCGCGTCCTCGCGATTGGCTTTGGTGTTGCGCTTGCTGTG
CGCGTGGTGGCGCCCGGGAGACGCTGCGGACGGTGAGCGCTTTAACTCTCCGCCCTTGCTGGACGGTCGCTTGCTCTTGTGCTTGAGGCTTTTGGTCTCG
CGCCCCAGCTGCTTGAGCTCCAGACTCGGGTTCTCCATCTCGTGCGTCTGCTCGTCCGACATCTTTTTCGCGTTTGGGTGGCGCGCTGAGGTTTTGTCTA
GTTCGATCTAGCGTACACTATATGTACACAAAATTACCTATACAAAACGCGAGTGGGGGTTTGAAGGATTATCATGTTGATGAAGTCAACCGCACTACGA
CCATCTTGAGGATATCGAGTACCGCAGCAGCGTTTCCCGCCAGTGCAGACACTTCGACATATATCACGTTGTGCTCACTGCACCACGTGCGAGCTGCTGC
TTGCTCCCTTTGGTCCAATTGATTAACGCAGTCGCTCTTGTTGCCGACCATCAACACGGGCAGTGCCTGCGTAGATTGCGTCTCGATGGCTTCGCCCGCC
GCAATCTCTCGATGAGCGACGTCGAGGTACTTCGGCAACGCGCGCCACGAAGCTGGCGTCTGCAAACTAAAAACCAGCACGATCGCTCGAACGCTGCGAA
AATAGCGCGCGAAGATGTTCGGCCCCGCGAAGCTCTGCGGCGGCACGTCCCACAGCTGACGAACTCTCCGTTAACTCAAGGCCAGATCATCCCAAGCATC
AAACAAGGTGACGCACTTCGAAAACTACCGGTTCGTGTCCCTCGAATCGAAGCAGCTTGGCACCTACGTTGGCTACACGGTGCAATGCCGTAATGTGAAT
GAGTTCACGCAACAGCCATATGACTCGCAGCCTCGCTTGCTCACCCGTGGTGGACGGCGTGTATTCCCCATCGAGCTGGGTCCCTATCAAACGCCTGAAC
AGCGTCGTCTTGCCCACTGCCGCCTCGCCCAGCACGACCACCTTCAGCTTGTCCAAGGTCAGTGGATCCGAGCCTTTATCTTGCACTGCGGACGTGTGCC
TTCGCCTGCTGCTGGACGCTAAGACCAGCACATCATTAGTCGCTGGCAGCTTGAAGTCGCCCGCTCGCCTTCGGACAGCGCTATACATGCATTACGCCGC
CCACGGTAGCCAAGGGCCCTTGCCTTACCTCGGGCGCCCATGCGCTGCGTCGTTTGCCAACCGAACTGCGGTCGCCGTCGGACAAGTCCCATACCGCTAC
TGTATAAAGGTCAAACTCCTGGTATAATCTATACCGCTATACAAGTAAAACGTATATCCTTGCATAACCGATTGCGATGAAAGTAAATTCAATATCGAAA
TTCGACCTTGAGAAGTAGTTTCTTCTTCACTACGATGCTACTGACGTATGGTCCACCATGCCGTAATCGAGATGTATCACAGTACGTCCGCTTGGTCCGC
CGTCGGATAAGGCAAATGGCTGCGGATGTGCTTCGGTCCAGAGACCCTGGCACGCTGCACTCACTCTACGATTCTCTTGTGCGCGCGCAGGCGACCGACG
CAATCTCTCTTCAACGCTAGCAATGGACTCCGTGGACGAGTTCAAGCTGTTCGCAGCGCTCTTCATCTGGGCGCTGGGACTGCTGGGCGGCATCGCGCCG
CTGCTGAGCAGCCAGCGCGTCAGCAAGCGCGCCAGCAGCGTGCTCAACATGGTGGCGGCCGGCATCTTCCTCGCCAGCTCGTGCATGCACTTGCTGCCGG
ACGCGCAGAACAACGAGGCGCTCAACGAGTGGGGCTGCGAGCACACAGCCGAGGTCTTCCTCGCCGTCCGGACGCACTACGACGGCGGCAACAAGCGTTG
CTTCAAGTGGGCCAACTTCTTTTACGGCTGCGGCTTCCTCATGGTGCTGCTCATCGAGGTGCTGGCGCACACGCTGCAGCGCCACTACGGCAAAGTGCAC
GGCCACGGCCATGCGCACGGCACCGATCAAGAGCGTGACGCGCTGCTAGCCATCGAGGTCACCCGTGCTGCCGAGCTGGACAACCTGGCCACTGCCAACG
AACACTCGCACGGACCCGCTCACGGACACTCGCACGGGCAACTGGAGACGGGAGACTATGGCACTCAAGCAGACGAACTCGCTGTCCAAGGCGAAGACGG
AAAGGAGGCGCCGCACTCGCACATTCACGGCATCGTGAAAGGCAACCCTATTTTGGCACTCGTGGTGTTCATCGCGCTGTCTTTCCACTCAGTCATGGAA
GGCATGGGCATGGGCGCCTCAAGCACGGCTGCGTGGGATATCCTCGTCGCAATCTTAGCTCACAAGTCGCTGGCCGCGTTCGCGCTGGCACTCGAGTTCG
TGCACCACAACGTCTCACAGAAGCAGCTTCTCTCGTCCGTGGCCATCTTCTCGCTCATGACGCCTACGGGCATCCTGTTCGGTCGGTTGCTGGTGGATAC
AAACCACGCCACACCTGCTGCTGGTGTATGTGCCGCGTTCGCTGGTGGCACCTTCCTCTTCGTCGCCATCATGGAGATCATCCCGCAGGAACTGCAGGAC
CCACGATACCAGATCGAGAAGTGCTCTGCTCTGCTCGCCGGCTACGGCGCCATGGGCGTGCTCTCCCTCTGGACGTAAAAACACTTTTGACTCATGTACA
AGTATTCTCGAAGATAAACAAGAGCGTCAAACGTCAGTAAGGGCATTCAAGAGCCCGATTCGCCTAGTGCGAACGTCAATTCAGAATTCACTGATAAACG
TTAGTAAAAAAGTTAATGAGAGAAAAAAACTTACTCAAGTAGCTAAACCACGCCCAAAAACGTCGAGGGCTTCTCTTCTCTCTCAATCTGGTAGCATGTG
GGTTGAACGAACCGCTGCTACTCCACACCACCATCGGCTGCTACAGGCTCCAATGCAGCCAGCGGATACAGCCATCCAGCAATCCTTGAGTTCGCATCCA
GCGTTGCCTCTGCTTATCTGCCGTACTTCTGGAACTCCCACTCGCGGTTGTCCAGCGGGCACACCTGGCGGGTCTTGAGCCACCTCGAAATACAGTGGAA
GTGGAAGGCGTGATCTGCAACAATAAAAATCACAATACGCCATTAGCAAATAATCCTCTCAATCCCAACCCCAGGCCTCCGACGTACTGCAGACACCCCA
GGCCACCGTGCACTCCTCGCTGGTGGCCGACGCCTGGTTGGCCTGGCACTCGATGCACAGGTCCATGATGTGGTTACGGCAGATGGCGCAGTTGTCCACC
ACGATGTCTAGAAAATTAAAACAACAATTAATTATCAAAGCCCAGTAAAGATCTCGGCGTGTTTGCGGCGGACGCACCCCAGGACCACAGCGCCACGGCG
TTCCACTTCTTGATCTCGAAGCGCTTCTCCTCGCTCGCGTTTGCCGCCGGCGCCACGTCCGCCGTCACCTCGCTCTTCATCTCCTCATCCATCGTGCTGC
ACTTGCTCGAGCTCTCGACGCCGGGTTGACCGATAGATAGTGAATGGTTTCTTCCTCTCGAA