Description :
From Genome Similarity Track
Location :
contig_47:280642- 295104
Transcript NameFunction/comments
g9689.t1RAW26828.1 hypothetical protein PC110_g16773 [Phytophthora cactorum
g9690.t1RAW26827.1 hypothetical protein PC110_g16772 [Phytophthora cactorum
g9691.t1hypothetical protein
g9692.t1POM70904.1 Zinc (Zn2)-Iron (Fe2) Permease (ZIP) Family [Phytophthora palmivora var. palmivora
g9693.t1hypothetical protein

Sequence
14462 bases(100 bases per row)
TTAAAATAAGCACCGGAATGGCAGCCTTGCGTGCAAAATTGCTGATCCGCCTGCGATGCTGCAGACCACCACTATATTTACCATGGACGCCAGCGGCACC
TCCCACCTGTGAGGCGATTTTTAGAGATGGAAACCTCCAGAACTGCGGTCTATCTCCGGACATGGTTCTTGTCCGACAACTTGGCTTGCAGAAGTAGTAG
ATGGCTCGTCGGTTGATGTCCGTTTCCTGAGCTCATTCTTGATTCGGCTTGAGCGAGTGCGCGAGGAAGAACAGACTGAGACCAAGCGACTGGCAGCATG
CGCTATCGGGAGGGACTCGCATTGCTCCTGAGCACGACGATGGGGTGGAGCCCGGTGCTTGGAGCAGCCACGTGGCCGTCCACCTGCTCGGATTCAGCGA
TGTCAGTGTGGCAAGCCACGTGTCCCGCGCGCACGGCGAACAACACCAACTACGTGTCGCCAACCGGCATGACTTCCGCTGAGATCAACGCCGACGAGGC
GAATGCCCTTGTAGCGTACAAGACGGCACGTCAGAGTGCTCTCAAGTTGAGCGCTGTTGCAGGAAATTCTGCAATGTCGGGAATGCGCCAGAAGAGCGAG
AGCTGGTACAAGAAATCGTTGGCGAGCTTTACCACCTACATCTGCGTCCAGTCCTCGACCGACGCAGAGCTGGAGCGCTGCGTGGACCCCTCAAGCAGTG
ATGCTATGCGCGACATCAATGGCAAATGCGTTGTCATGCTAGACGCTGACTCCTGCAACAGCAAGGACAAGTGCGAGCGCAGGAGCAATTGCAAGTGGGA
CGACGTCGTTCCTAATGGAAAGGAAGCCCGCCGTCAGATCTTCACGGACGCTGATGTTACTGCTGCGACCAAGTGGATGTCAACGGGGTACCCTAGTTCC
TTGGCCCCTTTTGTGGCTCCTGGCACCGTCATGGGTGTGCTTACAGCGTTGAGCTGCATTGGCTTCGTAGTGCTCCGATGCGTATTCAACCGCTGTGGTG
GTCGTGAGCCCAACGAGAAAGGCTACTCGCGCTGTGACGTCCTCGTCCCGACGCTCACTTTCTTGATCTGTTCGCTGGCAGTCTTCATCTGCATGGTCAT
CACAGCAGCACTCAATACAAGCATCTCGGATGGCGTTGAAGATGTTCTGTACTCGCTAAAGGCTACCTTAGAGAACGCCAACATCTTTGTGGCCAATTTG
CTGACGCCCCTGAACGACGCCACCGCTGAACTTACTGTAGCGTCGAAGGCGGTGAACGCTCAGCTGAAGAACTCGGACTGGATCGTGAATGACGGCGCCA
CGCTCAGGCAGATGATTGCGGATTTCGGTAGCATCTATTACAACCACGGCACATTCCCGACCCTGACCTGCGATCCTGCGACGAGCGAGACATTCTGCAT
GGCATGCCCCGACCGAGTTTGCGGCTCCCCCGTCACGTTCTTCGTCAACAACACCGCAGCCGCAATCACGGCAAGCAGCGACATTGTAGGAGACGCGGTG
GGCTTGCTTCTAAGCTCACTTGTGAACGGAAGCGCTGCACTCGACACGACTCTGCGTACGGCGAAACGGGATATTGCGGTTTTGGGCGCAGCTACAAACA
GCTCCATGGATGTCGTGGGCGTGCTTACCAGTACTTTCAACGACCTATCATTCTCGCGCAGCGCACTCGTGGTGTGCGTGTTCCTGTTCGGCATGATCTC
GTCGATCCTGGGGATCATTGCCATCGTAAAGAACGCCTGCACTGCTAAGACGACCCAGTGGGTGCATCTGCTTCACGTAAGCTGGGCGCTGGGTGTGCTT
GTGTGCGTGTTAAGCTTTGTGCTTTCGGCATCCCTCCTTGCAGTCGGAGCTGTGTGGTATGACTCGTGCGAGTACATGAAGCTACTCCACGAGGACATGT
CCCCGTACGCATCGACGCAGCTATCTGCGATGGCGAATGCTTGCTTCAACGGCAGTAATGTGCTCACACCGCTTGGTCTCGATGCTCCTCTGACCTTCTC
CTGCAATGTGGAAGACGAGTATAAGGTCGTGAAGACAGCGGACACCACGAGCGTCGGAACAGTCATCTCGAAGTACGGCGAGATCGTGTCCAACTTCGAC
CTCACCGATTTTAACTTCAACTCGACGCGCTCGAGGAACTTCGTGTCCAAGCTTGCCACTGCAGCTGAGGCCGCGAAAAAGAAGCCGGCCGTGAAATTCA
CACAGGAAAACATCCTGACTCCCTGGTTGGCATACAACGAGCTGGCCACATCGTACGGCTGTGTCAACAAGACCACGGAGGAGCTCCCTGTGTGCTACAT
GACGGGTCTGTGCGAGTCCGACACGTCGGCCAAGACGACAACGCAAGCCGCTTGCCAGCTTGCATTCTACGAGGCGTACGAGTACATGTTGGCCTTCGAC
AAGGCGAGCACGATGCTGGACGAGATGCGCGAGACTCTTCTGGGAGACACGGGCAAAACCTTCCCAGACCAGTGGAATTACTCCATGTCAATCTCCGAGT
TCGCCACTACGTACTTCACCAAGATTACTGCTCTGAAGACCGGCCCGCTGTTGACGATGCTGGGGGAGAAGGGAACGGTGCGCAGCCTCATGACGTCCGT
GGAGCGGGCACGCTGCTCGGGCGACTGCGCGTGGGCCAACCTGTCCTTCGACGCCATCAACGAGTCGCTCTGTCAGAACGTGCTGGGCACGACACTGGCC
ATCTCGTTGTGCGCGCTGTTCCTGAGTCTGTTCCTGCTGCCGCTCATCCTCTCAGCAATCCTCCTGCAGAAGCGTCTGCGCGGCGTGGCCAAGGGCACGT
ACGACCAGCTGGAGTTGCGTTTGCAGGAGCTGGAGCGCCGCGCCAAGCAGCAGAAGCAGGAGTCCGAGGGTCTGTCACCCAACGGCGAAAGCTCCAAGCC
CACGAGCGGCCTCAGTGCGCTCGGCGGGCTCTTCAAGGGCAAGAAGGTGCAGCAGCCGACGGGCTCTCCGTAACGCGGTTTATTAGCCTCCTTTTCTATA
AGCCAGCGCCGTGCTTGCTCAACGGAAGGTGAGCACACCAGCGCAGGACCTCGACTATTAAAATACAAGTAGCATTTGCATAAGTCAGCAGTTTGCCATT
TGCGAAAAAGTATCTTGCCTCTTCAACTTGCTCTGGACGCTGTTTCAGCCAATCAAAATCGATGCAGTTCTATGTTGAACCGCTGCATTTCTACCAACCA
GTGGCCAGTTCCAGTTCAGTATCACATTTCCACAGGTCATCGATGGCAGCTCGCGACGTAGTGGTGCTGGGTGGGGGCATCTCGGGCCTGACGCTGGCCT
ACTTCCTGCGCCAGGCGCTGCCCAAGGCCGCAGCCGATGCCACGCGTATCCGCGTGCTGGACGCCGGCCCCGTCCCTGGCGGGTGGGTGCACACGGCCAA
GCGCGACGGGTTCCTGTTCGAGGAAGGTCCAAGAGGTTTCCGACCCTCGCGCAATGGCGCCGAGATGCTGAGATTGGTGGAACAGCTGCAGCTGCAGAGT
CGCATGCAGGCCGTGGACCCGGCGGCACACGCGCGATTCATCCTGCGCCACGGGAAGGTGGAGAAGGTGCCTGGATCGCTACTGGAGGCGCTCCGGTGGC
CGCTGTCGCTGCCTGTGGCGCGCGCGGCGCTGCACGAGCTGTTCGTTAAACCAGGGACAGCAGAGGACGAGTCTGTGTACCAGTTTATGGCCAGGAGGTT
CAGTCCCTTAGTGGCTGAACGGCTGCTGGACCCCGTGGCGTCGGGAATCTTCGGTGGAGACATCAGGAAGCTCTCGATGCGCTCGTGCTTCGCCATGCTT
GTGGATATGGAGAGGAAGCACGGGTCGGTGGTCAAGGGGATGCTGTTTGGTGGCACTGGCGACGACACGCTGCTGGATGGCACCAACAAGTCGGACTTTG
TCAAGAAGCATGATAAATCGGTCAGTGTGAGCTTCACGGACGGCATGAGTACACTGATGGATGCACTGGCAGACAGTATTGAGAACGACCCGATGGCGGA
GCTGCAGCTGAACACGAAGGTGACGAGACTAGCGGTCCACGGTCTCGACAACGCATCGTCAAAGGCCCCCAGCTTCGTGGTGGAGAGCAAGGATCCCACG
TCCGGGGAGTATCGGGAGCCGATTAAGGCCTCGCACGTGTTTTCGACCATCCCGGCATGCTATTTAGCCCCGGCTGTGAAGGACACGGCGCCTGGATTGG
CAGAAGCGTTGAGCGAGATCAAGTTTGTAGACATGGGCATGGTGCACGTCGGATACAACGACAAGGTGCTGTCTACCGAGGGCTTTGGGTATCTGATCCC
AACTGCAGAGCGTGAAAAAATACTTGGTGTTGTGTTCGACTCCAACACTTTCCCTGTGCAGAACGCTGAAGGCAAGACGCAGACGCGACTGAGTGTCATG
AGCGGTGGCGCGCACTTCCGTGAAGTGGCGTCGCTGCCGGAAGGAGAACTGGAGCGCAATGCCCTGGATGCCCTCAATAGACATCTCGGTATCACGCGTG
AGCCTGACTACGTGCGTGCTATGACGATTAAGAACGGAATCCCGCAGTACCACGTGGGCTTTGCTCAGACGTTGCAGCGTATTGAGAAGCAGGCGGCGCG
CAGCGCACCGGGTCTGTTTCTGGGTGGCAACAGCTTCTACGGCATTGGTCTCGCTGACTGCGTGACCCACTCCAAGCAGCTCGCGCTCAAGTTTGCCAAG
ATCGCGTCGTCTTGAGAGAATAGAGCTACGAGGCAGTTGGTGCATGTGCACATTTTGGTGCCTGAAGAGTGCGTGCGTAGTGTGCGATGGTGCGTGAAGT
ATCTTCCACACTGCAGTGAAAATGGGCAAATTGCTACCGTTCTCTTTCGTGCCGGTTTTCGAGTTCTTCGTATTTATTTGGGCGGGCGTGTTGTGCAGAA
ACGGCTTTTCGGGAGCGACTTCTTCAGCTCGTCGATCTTTCGGAGCTGTTGCGTGCTGCAGCCAATATGTCGCGGACTGCGCCATCTCGAGCGCTTGATC
CTGTCTACGGTAGGCTTGGCGTCTTCGTTGTGGACATCTCGTGGGTCGCCTTACAAACTGTTCACTGTCCGCTGCAGATACGGTGTACACGGTCTCCAAT
TCAGGCGGCTCATTCCGCAAGGGTGTCTACCGAGCATCTTCGAAGCCTGCTAGCACTGTGAGCTCCATCGGTAACCAGAACCCGGCGGAGGGTAATGAAC
TCGTAAGCGGCAGCCAGCGGGTCAAGTTCCATCGGAGACCAGTGCTGCCGCACCTGCAAACGGAGCCACCGGAAGTTTTACTTGCTCCGGTATATGCCGC
CTCGGCACCGCCAGTCAAGCATCGAGATACGAAATTGTCAACACCCTCCCATGTTGCTGCCGATGTAGTTAATGGAAATACTCGGTCAGTGGGTATCCAG
ACTGTTTATCGCGAGTCGGAGGCGCAGACAGACCCGTACACACCAGACTACACCGTTCAAAAGACAGCTACTGGTTTAGCACCCGAGATTGCCACGCTTG
CGGGGCTAAGCCATGCACGTGGTCAACTACCAGTTGGGCAGGCGGAGCTGGAACTTATGGAGCGCAACCGCAAGAAGAGAGCTTTCGAGGCGTCGCTTCC
CCCCATGACCGACGAAGCGAGCTTTCTGTTGCGCAAGGCAATGCTGGAAGCACAAGAAACCGTGAATGGGCATTCCGCGAGGCGGAGATCGATGCTTTCC
ACGATCAGCGTGTTGTACTACTTGAGCAAGCACTTGCGGAGCGCGAGAAAGAGACCGCATTTCTTTCGGAGCAACGGCTTGAAGCGCTTCGTCAGCGGCT
GCTACATGAAAAAGAAAATGCGCTTGAAAGTATTCAACAAGAACGCGTGACAGCTCTGCGAAAGTTGACGAAGAAACGAGCTCAGAGACAGCAAGAGCGC
GGGTTTGGCGCATCACGTCCGGAGAGAGGCCGCGACATCATTGCCGAGTACGCGAACTTCGGCTCGCAAGTATATGCCCCTGTCACCCGAGATGGGAAGG
CTGGCAAAATCGAGGTTCGTGAATTGGGCATCGGGAAGGCGCAGTTTTTGCAGCTTGATGCTTTACGCGAGCTTGAGAGTGCTTTACCTGCGCGGATGTT
ACTTCCTGCTGCTGGCAAGTACAAACCCCGTGAGAAGAGTGGCCACACTGCCAAGGAAAGGAAGCAAGCAGCTATAGAAGCCCACCTCCTGAAGATGGAA
TCGATCATCAAGAAAAACAAGGAACAGAAGGAAAGTACCAGTGCGGGTGATACTACCCCTGGAGCTCATAACAATGCTCGCCTGAATGCTGCTAGCCCGC
TTTCACGACGAGCGAGTCAGAGACAACCACTAGTACGTCCACCCACACCTGACTACGCAGCGGGTCATACGGCCGATTCGCAAGAGAACGAAGTGGAGGA
TGCAGTACGCTTACTGCAGAAATTGCTGCGCGGCCGTGCTGTCCAAAATATGATGTTCGAGGGTAAGGAGAGGCGTGCCGAGCTCATTGCAGAGCTGCGT
GCAGCCGACGAGCAACTAGCTCTGCAGCACCGCCATGAATTCGCACTCGCGCAAGGTTCTGGCAACGAGGCAATCGACCGTGTTGCAGACGCAGCAAAAA
CCCGCGTGGAGGGCGAAGTGGTTTCTGAAATGCTCGACTTCTTGTCGAAAGAGCTCTATCGATCTCGTGAGGTGGCTAAAATGCGTGCTTTCGTGGCCAA
GGCAGCTGAACAGCGTCACGTGCGCGAGGTAGAGGAAGGCGGGCGACGACAAGCTGAAGACCTCTTACGTGAACGGGAAGATGAAGTATTCCGACGGGTT
ATGCAGGTGCATCAAGAAACATCCGCGACTTCGTTGACGACATGCTGGAGGATGTAGCTCTGGAACAATCTCATTCCCAAGCGCTGCAGGAGCTACACGT
ACGCAGCGCTGGTGTCGATGGACTGGTGCTTCAGCTGGAGAGTGAACTGGACAGCGATGAAAATATTGTGCGTGAGCTAGTGGCAAGCTTCTTGCTACCA
CAAGTCCACAGACAGCACGTACGCCGTCAAGTTACTCAGGAACAGAGAAAATATGTGACGGCAGCCCACGCTTTACTAACAGAGATGGTTACCGGAATGA
GTCAACCGAAACCCAATTCCAGTAGCAACGAGGCAACAGAAGACATTCTTTGACACATGAAGGAATATAAGGCTTATTGAGGCGCTAGCCAACATGGTGA
CTTATCCTTGATGCACAAGCAATAATGTCTTACTCGTTGCGTACTCGGATTTCACAGCTAACGGGTCAATTCACGTGATAGCTACTTGCCGCTCGCACCC
CCGGCAGAAATACCGGTGGTGCCACTTCCTGCAGACTTGAGGAATGCATCGAGATGCTGTCCTTGATACTTGAGAAAGTCTAGCTCCTCTTTGAACTTCT
TCTCCTGCAAAGCTTTGCGCTCGGCCGCTCGTTTCTCAATAACCTCGAGTTTGTTGGTTAGCTCCGCCACTTTGCTTTCGCTCTCGTCCTTGTCACGCTG
AAGGCTGGCGATCTGCTCTGCCAGGTCACCCATGCCGTCTTCGGCCTGCAATTGTTTTCGGACGCCAAAGGTCAAACTCGAGTCGTACAGTGTCTTGTAG
GCATCCGTAGTGAGTCGAAGCTCATCACGAACGCGTAGAAGCAACAGTCCTCGCTCGGGGCAGTTGAGTGTCACCTCACGAATAAGCTCATCGAAAGCTT
GCGAGTACAGATCCTCCCGGACGGGACAAATACCGCTTTCACGGGCTTGTCGCTGTAGTAGCTTGGCATCAAGTGCCTCCTGCAATTTCAGCACATCGAA
GCGAGTCGAGGGCACGCTGGACGCGTACCGAAGCCAGAAACCTGAATTCTCCTCGGACCACATCCTGAAAACAGCAGAAGCGATGGTTTAGCACATGTCA
TTGCAAGTGATCGGGTGGTGATAACGGTGACGCACTGGGGCGGTAAGACAGCATTTAGGATATCCTCGACCTTTGCAACACCATCGGAGCTTTTGCCATT
AACTGCCCCACTCGACTCCGCGGCTGCTGCCACTACAGTTGCTGCGGTGATGGAATTCGAGGAACCTGCGTTGGCAGCACCCGGCGTCCTCTTCGGTGGG
TCTAGCGTTTCGCCCGTGAAGATCGGCTCGCCATATTGCACGAGGGATTCTGGAGGTGTCGGTGTTGACATCTTGCTCGTACAAATGCTTGGTGTTTCTC
CAATTCACGTCTGCTAGCAACCGTCGCGTCCGTTCACGAACTCAACTTATCAAGACTCTGCAAACGCACCCCATCGTTATTTGCTTTTCTGCCTACAACT
TCCTAGTGACGCTGGTTAGATTTCGCAGCTACAAGCTCCTGCTTCTCCTGACGCTTGCGCTCCGAGAGTTCTTTGGTTAGCTGCTCTGGGCTCTTGTAAT
TGTCTTTGGCACCAACTTTGCGCAGCCACTTGCTACTGTTGGTCTGTCGTGCTGCCTCCAACGCTGCAAACTTCATCGAACCAACACGAATGAATCAGTA
AAGTTCAAGACAGGATGGCATCATTCTCACGCACGTGCTCTTTGCGAAGAGTCTTGGTGAGCTCGATCGACTGGTTCCAAGCCTTGACGTCACACAGGTC
TGGGTGATTGGGTAGCTCCTCTGTGCACTTAGCAATACCCTGCAAATCAGAGAGCAGGCACGTCAATAATCCTGCGGACACTTAAGACAGTTCCCCAACT
GATAGCCATACTTTCATCACGCGCTCGTCGCCGAAGGCTTCTCCTATGTACTCGTCCTTCAGAGCCACCTCCAGGATGCCAGTGTTGAAGCGGTTTGATT
TAGGCTTCAGTGTTGGATTCTTCTGGGGTAACTTTTCGGCACGGAAGTTGTACGCGAACATGTGGGCACGATTTCTCTACAAACGCCACAGTAAAGTGTA
GCTTCAGGAAGGAGAGGGCGATCCACTCATTTCTCAAAACGAAGCGTACCTCAGCATTAACATTAGTTCTCTTGTAACACTTCCCAGTCATCTGCATGTT
GTCCCAGTTCGAAGTAGAAGTCTCCCATTGTGGGGTCTCCGCCGAAAGAATGCGCGAGCGAAGCATTTCAACGACCTCCAACTTTGCCGCCGCTTTGTCG
GGCGCGGTATCAACTGGGCAGAATACCCGTTCTTCAAAAGAGTAGTTGATGGGTGCATCCTTTCCACCAATACGCTTTTTCGCATGCATGACAGTAGTGC
TTGATGGAGGACTGCCAGTCGCGAGTGATGAGGTGCGCGTGGTGCTTGCGGCAGATTTCATTGCCTTCTTCTTCTTCGACCACTGAGAGTCCCCGCTTTG
GTCTCTTTGATGCACACGCCCAAACAAACATCGTCGAGAATATAGACCACGCATCATAAGAGACAATGCAGGGATCTATTACCGTCGACAAGTGTGAATC
GATCCGCTATTAATTGATCTGGTCAGTGCATTGAGAACACGTGAGAGCTTGTCTTACCTGCAGATACTCTCCACATCTCAAGCCGACTCGGTTGCAGCAG
CTGAAGCGGTTTGAACTTGCTGGGCCTGCCGGATACTATTGCGCTCGGCTTGAAGGTGGCGACACAAACTCTCGAGCTTCTTAAGCTTCTCCTGCAACTT
CAGCGTTTCCTCTCCAGTTGTCACCTTCTCCTGGATAGAGGCAATCGCGCCGCTGTCATACGCAGCACACTTTTTCCGAAGAGCAAGGTTCTCCTTCTCC
AGCTTCTTGGTCGTTTTTGCCATTTTGTCCATTTCCTCACGGAATGTCGTGAACATCTGGTTACTTTTTGTCAGTGTCTCCTGCACGACGTCGAACTTTT
CAGAGTAGGAGTTCAGCTGCGCCTGTAGCTGAACCTCGCGATCGGAAAACTCCTTGGCCTTGTCGAGGGTAATCTTAACCTTTTCTGCCTCGCGTGAAGT
CAGCTCTACCTGGTGCTGCAGCTTTGTTTCCGCAAGCTGCACTGTCAGATCCTTAGCCTCGAGCTGCCGCTGGAAGTGCTCTTCTCGAGCAGTATACTGT
TCAAGGAACGTCTTCAGTTTCTGCTGGAGGCTACAAATATCATGCACATCCAGGGTAGGCAAACGTCAGTTAGAGTGTTGCGTCACTGGTTGGGATAAGG
AACTTGGTCACATACTTTTCATTTTCCTTCAATGAGGCCACGTAGTCCTTGCTCTGCTGATCCATTTTCAGGCTCACTTCTTCGATTGTCTTCTGAAACT
GAGCCGACAACTCACGTCTGCAATCCCGACATGGACCAAACACGCAACGGTTAAAAAATAATTCAATAAGAAGTCCCCAGTCACATCGCACCCACCTCTT
CTGGTCCTCTTCATCGGCAATACGACGGCTTTCACTCTGGATACAACAAATGATGGTGAGCTCGTTATAACGCTGGAACAAGAGCTAGAAATCTCCTCAC
CACAATGAGCTTGTTCTGCTTCTGCAGCTCCCTGCAGAGCTGCTCCAGCTTGGTCTTGGACGTATTCGTCTTCAACAGCTCCGTGCTCACTACACAACAT
CCCGAGACTCATCAGCACAGGGAGGTACTTCACGATCTCTTTGCAGCATTCACCTGCGCTCTTGCGTTGCTTCAGCAGAATGCACTTGGCATTCAGCTCG
CCAATCTTTTTCTGCAGCAGACCCAGTTGTTCACCCTGCAAATTCTACACACGTCAGTCTCCACCTCTTCCGCCCCAACAACTGCCTAAACACGCACCGC
CTGGTTGAGACTGTTGACAAGCTCCACCACCTTCTGCTCCGCCGGCATTTCCTTGTCCTCCTTCACAGCCTCCGCCTTCTCCTTGAGCTGCGTCAGCAGC
GTCTCGTCCTGGTAAATTCCTGTCACAAACCGTACTTTTCAGTATTTTATCTCTCGAAACTCGCGCTTTTTCGTCGCACCCGTGAGCTCGATGGGCGCCT
CGAGGTTCTCGTCGCCGCCCACTTCGATCTCCGCGATTTTTCCGGCCAGCAGCTCCCGCAGCGCGTCCTCGCGATTGGCTTTGGTGTTGCGCTTGCTGTG
CGCGTGGTGGCGCCCGGGAGACGCTGCGGACGGTGAGCGCTTTAACTCTCCGCCCTTGCTGGACGGTCGCTTGCTCTTGTGCTTGAGGCTTTTGGTCTCG
CGCCCCAGCTGCTTGAGCTCCAGACTCGGGTTCTCCATCTCGTGCGTCTGCTCGTCCGACATCTTTTTCGCGTTTGGGTGGCGCGCTGAGGTTTTGTCTA
GTTCGATCTAGCGTACACTATATGTACACAAAATTACCTATACAAAACGCGAGTGGGGGTTTGAAGGATTATCATGTTGATGAAGTCAACCGCACTACGA
CCATCTTGAGGATATCGAGTACCGCAGCAGCGTTTCCCGCCAGTGCAGACACTTCGACATATATCACGTTGTGCTCACTGCACCACGTGCGAGCTGCTGC
TTGCTCCCTTTGGTCCAATTGATTAACGCAGTCGCTCTTGTTGCCGACCATCAACACGGGCAGTGCCTGCGTAGATTGCGTCTCGATGGCTTCGCCCGCC
GCAATCTCTCGATGAGCGACGTCGAGGTACTTCGGCAACGCGCGCCACGAAGCTGGCGTCTGCAAACTAAAAACCAGCACGATCGCTCGAACGCTGCGAA
AATAGTGCGCGAAGATGTTCGGCCCCGCGAAGCTCTGCGGCGGCACGTCCCACAGCTGACGAACTCTCCGTTAACTCAAGGCCAGATCATCCCAAGCATC
AAACAAGGTGACGCACTTCGAAAACTACCGGTTCGTGTCCCTCGAATCGAAGCAGCTTGGCACCTACGTTGGCTACACGGTGCAATGCCGTAATGTGAAT
GAGTTCACGCAACAGCCATATGACTCGCAGCCTCGCTTGCTCACCCGTGGTGGACGGCGTGTATTCCCCATCGAGCTGGGTCCCTATCAAACGCCTGAAC
AGCGTCGTCTTGCCCACTGCCGCCTCGCCCAGCACGACCACCTTCAGCTTGTCCAAGGTCAGTGGATCCGAGCCTTTATCTTGCACCGCGGACGTGTGCC
TTCGCCTGCTGCTGGACGCTAAGACCAGCACATCATTAGTCGCTGGCAGCTTGAAGTCGCCCGCTCGCCTTCGGACAGCGCTATACATGCATTACGCCGC
CCACGGTAGCCAAGGGCCCTTGCCTTACCTCGGGCGCCCATGCGCTGCGTCGTTTGCCAACCGAACTGCGGTCGCCGTCGGACAAGTCCCATACCGCTAC
TGTATAAAGGTCAAACTCCTGGTATAATCTATACCTCTATACAAGTAAAACGTATATCCTTGCATAACCGATTGCGATGAAAGTAAATTCAATATCGAAA
TTCGACCTTGAGAAGTAGTTTCTTCTTCACTACGATGCTACTGACGTATGGTCCACCATGCCGTAATCGAGATGTATCACAGTACGTCCGCTTGGTCCGC
CGTCGGATAAGGCAAATGGCTGCGGATGTGCTTCGGTCCAGAGACCCTGGCACGCTGCACTCACTCTACGATTCTCTTGTGCGCGCGCAGGCGACCGACG
CAATCTCTCTTCAACGCTAGCAATGGACTCCGTGGACGAGTTCAAGCTGTTCGCAGCGCTCTTCATCTGGGCGCTGGGACTGCTGGGCGGCATCGCGCCG
CTGCTGAGCAGCCAGCGCGTCAGCAAGCGCGCCAGCAGCGTGCTCAACATGGTGGCGGCCGGCATCTTCCTCGCCAGCTCGTGCATGCACTTGCTGCCGG
ACGCGCAGAACAACGAGGCGCTCAACGAGTGGGGCTGCGAGCACACAGCCGAGGTCTTCCTCGCCGTCCGGACGCACTACGACGGCGGCAACAAGCGTTG
CTTCAAGTGGGCCAACTTCTTTTACGGCTGCGGCTTCCTCATGGTGCTGCTCATCGAGGTGCTGGCGCACACGCTGCAGCGCCACTACGGCAAAGTGCAC
GGCCACGGCCATGCGCACGGCACCGATCAAGAGCGTGACGCGCTGCTAGCCATCGAGGTCACCCGTGCTGCCGAGCTGGACAACCTGGCCACTGCCAACG
AACACTCGCACGGACCCGCTCACGGACACTCGCACGGGCAACTGGAGACGGGAGACTATGGCACTCAAGCAGACGAACTCGCTGTCCAAGGCGAAGACGG
AAAGGAGGCGCCGCACTCGCACATTCACGGCATCGTGAAAGGCAACCCTATTTTGGCACTCGTGGTGTTCATCGCGCTGTCTTTCCACTCAGTCATGGAA
GGCATGGGCATGGGCGCCTCAAGCACGGCTGCGTGGGATATCCTCGTCGCAATCTTAGCTCACAAGTCGCTGGCCGCGTTCGCGCTGGCACTCGAGTTCG
TGCACCACAACGTCTCACAGAAGCAGCTTCTCTCGTCCGTGGCCATCTTCTCGCTCATGACGCCTACGGGCATCCTGTTCGGTCGGTTGCTGGTGGATAC
AAACCACGCCACACCTGCTGCTGGTGTATGTGCCGCGTTCGCTGGTGGCACCTTCCTCTTCGTCGCCATCATGGAGATCATCCCGCAGGAACTGCAGGAC
CCACGATACCAGATCGAGAAGTGCTCTGCTCTGCTCGCCGGCTACGGCGCCATGGGCGTGCTCTCCCTCTGGACGTAAAAACACTTTTGACTCATGTACA
AGTATTCTCGAAGATAAACAAGAGCGTCGAACGTCAGTAAGGGCATTCAAGAGCCCGCTTCGCCTAGTGCGAACGTCAATTCAGAATTCACTGATAAACG
TTAGTAAAAAAGTTAATGAGAGAAAAAAACTTACTCAAGTAGCTAAACCACGCCCAAAAACGTCGAGGGCTTCTCTTCTCTCTCAATCTGGTAGCATGTG
GGTTGAACGAACCGCTGCTACTCCACACCACCATCGGCTGCTACAGGCTCCAATGCAGCCAGCGGATACAGCCATCCAGCAATCCTTGAGTTCGCATCCG
GCGTTGCCTCTGCTTATCTGCCGTACTTCTGGAACTCCCACTCGCGGTTGTCCAGCGGGCACACCTGGCGGGTCTTGAGCCACCTCGAAATACAGTGGAA
GTGGAAGGCGTGATCTGCAACAATAAAAATCACAATACGCCATTAGCAAATAATCCTCTCAATCCCAACCCCAGGCCTCCGACGTACTGCAGACACCCCA
GGCCACCGTGCACTCCTCGCTGGTGGCCGACGCCTGGTTGGCCTGGCACTCGATGCACAGGTCCATGATGTGGTTACGGCAGATGGCGCAGTTGTCCACC
ACGATGTCTAGAAAATTAAAACAACAATTAATTATCAAAGCCCAGTAAAGATCTCGGCGTGTTTGCGGCGGACGCACCCCAGGACCACAGCGCCACGGCG
TTCCACTTCTTGATCTCGAAGCGCTTCTCCTCGCTTGCGTTTGCCGCCGGCGCCACGTCCGCCGTCACCTCGCTCTTCATCTCCTCATCCATCGTGCTGC
ACTTGCTCGAGCTCTCGACGCCGGGTTGACCGATAGATAGTGAATGGTTTCTTCCTCTCGAA