Description :
From Genome Similarity Track
Location :
Scaffold_122:28060- 32749
Sequence
4689 bases(100 bases per row)
CCACCTAACCAGGCTTACCGCGTGCGCTCACGCTTGTTATCAACTGGTCAGGGTAAGAATGAGTTAACGGAATATGTCCAAGAGCTGAGAACTCTCATGG
CTGCTATGCAGTCTGACCCTCTGCCTGAGGCAGTCCATGTGACTATATTCATGGGGGGTATCCGTACTGGCATTGCCAGAATCGAAGTCTTTCAGGTTCA
CCCCTCTACATTCGAAGAGGCTGTGAGAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGGACAGACTTGGCTGGAATGGGTACAACCCTAGCTCTGCG
AGAGCAAACTCCACGAGTACTTCGGCCGTTAATAGGCCGGAACCGATGGATCTCAGCTATGATGAAGATGAAGATGAAGTTGAACTTCAAGTTGCTGAGC
AGAAACGTGTTGTACGACGGTGTTATACGTGCGGAAGCACTAAACACTTGCGGCCTGGTTGCCCTTTGCATAGACAGCGCCAGGATACGAGTCAACACTC
TACCCCGAGCCAGAAGTCTGGCATGGCACGGGGAAATGTCGACACCCAGTAGACGTGGGGCGCCCTACTAAGGAAGAACTAGGTTCTGTAACACCTTTAG
GAGGTAAAGTTGAACAGGGCTTAGCCCCAAAGAGTTCCATACCTACTGGTATGGAGAGTGGATAGAAGTCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAA
AGGCTTTAAAAAACCTTGGTCAATTTTAATCGATTCTGGGGCGTCTTGAAATTATGCTCGTCGTCGTTCCATTGAAGAAAGTCAGCGTTATGCTGAAGCG
CTCACAGCGCATGAGGGTGATCAATCACGGTTCGTTAAGCGACTGGAAGTCGTGTCACAGTACCTAAAGTTCCGTTGAACTTAGGTATAAAGTTTGGACT
TTGATAGCATTGAACGCTGTCTTGTCCTTGATTTGGACTCGAGATATGATCTCATTCTAGGTATGGCTTGGATTAAACGCCATGAGCCATGGATTGATTG
GAGGTCGAAGAACTTAGGCGCTACGCGCAATGTTCCTAGCGAAGTTTTGGAGAGTCATGAGCCCACCTTTCTTAGGCAACGAAAGCACCATTTGGCGCGA
GCCTTTGACAGATGATTTCAATGTGCTGGACATTGGAATGTCTGAGTAAACTAACTTCAATGTTGAAAACATGGATTCCGAGCGTAGCTCGTTGAGTATT
AGTGATACGTCACGTACTCCGTTGAGTGTTACTCGTTGTGATAACGAGTAACTGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTG
ATTCGTTTGATGTGTGTGTGGTGGCACATGAAAATGTACCGAGTGCGGTCGGCCGTGAAGGCACCACACTTAATGTCGGTAATGACATTGTTGGAGAAAC
GCCATCAAGTTCAGGGCTAGGCCCGTATAATATAAGTGGAGTGGCACTTTTAAATCTACTGGGTGAAGTGTTCGAGTTACGTAACACTTCACCGGATGTC
GATCAAGACATCAGCTCTCGTATAGAGCGTACTACGAGTAGTAGTAACCACAGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGA
GACGACCTGGACACCAGGCGGCAACTGTTAAGCGCCAGGCGTCCGAGAAGTCACATAGTGACAATTAGTGATACACTATATACACTTGTCAACAGAGTGA
CTGGCCAGGTGGAGGGCAATGTTAGCCTGGAAACCCTTCCATCTTTTGATGCTCTTTGTGAGCTAGACGAAATGTCTGATGGCAAGTCTAGCCAGGCCTT
GAAGGCAGAGATTTATCCGAATTAGTGGTCATTAGACCCGATGTCGAGTTGAACCCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGACACCATGGCGG
CACTCAGTGCCCGAAGTGGATATTCGATCTTTAAAGATCCTTTGGATCCATTCTATCCTTTGGTAAAGGAATTTCAATATGTGGTGTGTCACAACCCACC
ATCTGTCTTACCTCCCGGTAGAAGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTAACTAAGGAACAG
TGTGACGTCATTGAAAATTTATTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGC
CTAATGGTAAGTGGCGTTTTGTGCAAGCTTATAATAAGCTTAATGCTGCCACTATCCTGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAA
TATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAACGGTTAGTACC
CCGAGCGGTATGCCCTGGAAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCCGGCTACTTAAACGTCTGATAACGCAACTATTCAGACCTCATCGA
GGCTATGCACAAACCTACTTTGATGACATCTTTGTCCATAGTCTTGCAACGAACGGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTGC
TCGAGTGCATGCGCACGAATAAATTGTATACAGATGCATCTAAGTTCATCTTTGGTGCAGAAGAGATTCTCTTTCTGGGGTGCTTCATTGGAAAGCGAGG
CCTTCGAGCGAACCCCGCTAAGGTAAGGGCCATAGTCGATTGGCAGGTTCCAAAGAATCAAAAAGATCTACGCAAGTGGCTTGGCCTTGACAATTACTTG
CATAAGTATGGTGCGAATTACGCAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATATGGATTGGGATTGGGTAACACCGAACATGATGCTTT
TCAAGCAGTTAAGGAAAGTCTCTTTCATGCGCCAATACTGCTTTGCCCGATCCTGATCGGCCTTTTAGTGTCATCTGTGACGTATCTGACTTTTCTATAG
GCAGTGCTCTGTTACAAACAGATGTCGATGAACGCTTCATTGCATTCGAATCTCGACAGTTCAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGA
CCTATTTGCTATGAAGTACGCTCTAGTCAAATTCAGAATACATCTGCTTGGCTCAAATCCATTTGTGATCTATACAGATCATGCATCATTGCGCACTGCG
ACACAGTCGCCGCATCTCTCTCAGAGAATGGATCGTTGGCTTTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAAAGCTT
TGGATGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCGTCATTCATGACTAAATCCGGGCGGCTTATGCCAAGGAT
TAACAATGTGTATCTTTGCTACGTGCTCTTGGAAGCGAGGAGTTTATAGACTTGGACATAGAATTGTCGGCACGTTTACGTGCAAGGCTACATCGATATT
CTATCCATAATTTCCTGTTGTGCGATCGCACAAATATTGAGGACAACTTTCGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATACTCTATGA
GGTACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAACTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTGAGTGAGG
AACTATGTGCGTACGTGTGAAGGGTGTCAACGGGTTAAACCCTCAGAACATGCGGCGGCGCCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGT
CCATGAGTATGGACTTTGGGTTCTGCCTACCGAAAGATTCGAAAGGCAATATTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCAAGC
GGCTGTGCCGGACTCTATTGGTGCCGAAGGTACATCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTGCCAGTGACAATTGTCTCTGATAGA
GATCCCCGCTTCACTGAGAAGATTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTTCACAGCGGATCATCCGCAGACAGATGGTCAAA
CTGAGCGCGTTAATCGCGTCATTAATGAAATTTTGCGCAGTGTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGATCCCTATTGTTGAGTTTGCGTT
TAACAACGCTATTCATGCCTCTACAGGCTATACTCTGTACTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTAGTTCGGGG
TTTGGTGGGGGTAGGTAGCCGATCGGCTTGCTGATATCAGACCTTCTACTATTCAAAAACAGGTCGGCGCGTTCTTAACTACACGATTGAATGTCTTACG
ACATGCATGTGACGAAATGGCTGATAGCCAAGACAAACCGAAGAAACAAGTGGATGCAAAAGACAGAAGCTGTATTGAACGTTATAAGGTCGGTGACAAG
TCTTACTAAACGCTAAAAATCTACCTACAAATGTAGTGTCTACTGTGTTTAAGACTAAGCTGCGTCCTCGCTTCATTGGACCATTTACGGTCGTGGGCCA
AGAAGGGTCTTTCGTATACGCTCAACTTACCGCGCAAATTGCGTACACACCCGTGTTTTACATTGGCTTCCTTAAGCCGTATCGGGATC