Description :
From Genome Similarity Track
Location :
scaffold_199:28056- 29355
Transcript NameFunction/comments
Pl_107836HECT E3 ubiquitin ligase, putative

Sequence
1299 bases(100 bases per row)
GAAGGTTCGCACTAATGTGCTGCGAATACCACCAGCGAGACTTGATACACCCCATGACCGTGCTGAAGTGCCACTTCCTAAGTCTTGTCCGGTTGCGGTT
GAAGCAGCATTCAACCATGAACTCAGTATGGCATCTAGCCTCTTGAATCCACCTAGTGTCATGAGATCCAAGCGGTTGGTTGTGGCACTGGCGGGTTTCA
AGGCTGTAGTATCGCTCGCGTCGGTGTCAGTGCTCGAATCAGTGTAGGTGCTGCTACTACTTTGAGACCTCAAGTGCGTGTTGTATTCGATCTCAAGCTT
GAAGCTCCACGTTCGCAAATGCATGACTCCTGCCTCGAACGGGGCCGCTTGTAGCTCGTTTCTATTACTGCGCGCGAAGTTGCTGCGGCGAATATTTTAT
GTTAGGGAGATACAAGAAAATTGCAACTGCACAGGCAGGGACTCACTCAATAGTGACAGTGATACACTGCTCAATAAGTCGAGGGAACAGGTCAAGGTAT
GAAGCAGAAGGTTCTGCTAGCATGCGTTGGCCCATGGGCTCTAGTAATTGCTGCACAAGTCGCTCAACAAATTCTCTCTGCAAACGTAGACACAAGTGAG
ATTGATGCGAAAGAGAACTGCACGAACATCGGCCAACCTACCGCCGATATCCGCGTTCTGCCTCCATCTTTACTTGCTGTGGGAGTACACATGTGTTTTG
CAATCTGTACATCACCAGTGTGGAGCACAAAGTTGGCAAACTAAGAAGTGCGAAGATGAACGTGAATTCTTACCATCTCGACAACCTCCACGATGGTTTC
AGTCAAATCTGCAAGGTGCACCTTGAATTCTGCGTCGATATTTGTAAGCTCCATGGTAATGTGGTAAATTTGAGGGACGGAGTCTCGAGTAATTCGAGGC
GTGCACATAATTCCAGTGTCCATTGGATCCCGAGGTGTTGAAGTTACAGAGGAACAGGCCGACGAGCCTGAGGATGCTTGTGATGTAGTTTTCGGGGTCT
TCGACTGATGAGTAGTGCGCTTCGGATGAGCACTTTCATGATCCATCCCTTCGTTACTTTCGACAAGCCTTAAAATGTGCGCAGTTTGGAGCGAGGAGCG
CGTGAGCACATCATGCTGGGCTAGCATTGCCCATAGCACGGTGTCAGATTCACCTCTGTAGATGGTTCCGTCTGACGTTGTACTATGGTGTCGGACAGAA
GCAAAGTTACTTCCCCACAACTGTCGTGTCGCTTTTGTCCATGCCAGGTACTTCCGAAGTGTCGGTAGGAACATCGATAGGAGCATCACAAATGGACAC