Description :
From Genome Similarity Track
Location :
Scaffold_26:280548- 282631
Transcript NameFunction/comments
Phyra_77742phospholipase D-like protein

Sequence
2083 bases(100 bases per row)
TCCAAACGGTGTTTTCATTCTTTTTTACTCTCAATCGCACCCGATGAACACGATTGGGCTATCCTCTCAACACAAGAGAGAGGAAGCACTAAAAGCCAAA
GCTATACAGACACATCATCCACCACGTCACAGTCTGGGGCGCGCTCAGTCGTCGCCCTCGACGTCCGGGTCCACGATCTGGCGCAGAGCGTCCGGCACAA
AGTCAAAGGCCGCGCTGTCCGACACGGCGTACGGCTCGATAAGGCTGGAGCCATCGTCGTGCGCCGCCGTCTCGAGCGCGTCGCACGCCTCCAGGAACGT
CATGGCGTCCAGCTCGTCGTACGTGCGCTTGGTGGCCTCCATGAACTTCTGGATACGGAAGTTGCGCGCCAGCTTGTTCACCGTGATGTTGTCGGGAGAC
TGCACCAGCTCCGTGTCCACGATGTTGATGCCGATCTCCGTGTCGCTCGTCATGCTGCGGCGGTTCCAGTTGGCCGAGCCCAGGGACACGTACACGTCGT
CCACGATCACCAGCTTGCTGTGGATGTACAGCTCCTTGGACTCCTTGGTCGAGTACAGCTTGAACTTGTCCGGGTACGCCTTCTGGATGGGAGATACCAT
GTCGTACAGGTACTTGGCGTAACCAGTGTACCCGGCCTCCACCGTGCGCTGCACAATGACAATGAGGCGCTCGATGCTGGGCATCATGTCCATGATGGCC
TCCAGCAGCTCCGGCACGAGAATGAAGTACTGGTCCTGGATGAAGATGTAGTTCTGCGCGTTCCGGATCGCCTTGATGCGTGCGTGGAAGATGGACTGCT
CGCCCTGCGGCGCGAAGCCGTAGTGGTCGTAATCCGGGCTGAAGGTGCGGCACAGCTGCACGGCGTGAGTGCCGTCCTCGGGGATGTCGAGGGCTGTGTC
ACAGTCGTCGATCTGCGGGAGTTTCGAGTAGTCTGGGTTCTCAAAGTCAAGCAGGTCGTCCATGAGGTCCTGCGACGGCTTGTCGTCCGAGTTCCATCGG
TCCAGGAAGTTGCAGGCCACGTCCTTGGTAGCAGGGCCCTCGATCTTTGCGTGGGCGTCCAGCCAGCCGTTCCACAGACACTTGATGCCCGTGCGTTCAC
GCAGCTCGGCCTGGTCGTGCTCGAGCGTGTCCCAGCGGTCGTTGGTCAGATCCACGCCGCCCACGTAGGCCACGAGGTCGCGGCCCTTGCGCACGATCAC
CGACTTCTGGTGGTGCGACGATGTGGCATGCGGCAGGCGGTCGTCGTACACGAAGCGCGCAGGTCCGTACTGTTCCGGCGGCGGCAGCGCGTTGATGAGG
TCGCGCACCTCGTGGTTCTGCGCACGCTCCGTGACGTTGGACCACACGAGCATGCGCCAGTCGGCGCCGCGCTTCACGGCGGCCTCCGCCAGGTCGCAGA
GCTTCGTGTCGGGCTCGTGGGGCTTGAACGGCACGTTGCATGTGCCCCAGCCCGTGAGGTACACGAGGTCGCCGCGGCGCACGTCCAGCATGTCGTCGGC
CACGTCATTGAAGTAGCCGGCGGACGCGGCGTACAGCTTGACGCGGTTGCCCTTGGAGTACACGTGCATGCCGCTGCGCTCGTAGCCGTCGCGCGACGTG
CTCAGCTCCTCCCGGGTCAGGAACCAGCGCGAGGGCTCGAGGAAGGGCTGGTCGAAGGGCGCGGTGGCCGCCTTCTCGGGCTTGTGCTCCTTCTGGAACG
GGTCCACGATGAAGTGGAACGCGCGGCTGAGTCCGTCCATGGCTGAGTGAGGAGGAGAAGCAGGACACTTGAGCTCGAGACGGCAGAAGCAGGAATGAAG
GGAGATCTCTTGCGTGTGGAAATCATGTTGGATATGGGCCAATGGGAGCAGGCGACGAGATGTGGGTTCAGTTATGAGGCGGCGGCAGAAATGACCACCA
TATTGTTTTGAGACGACTCGCTGGCGGATGGCGGGGGGCTATTCCGCGGGCAATCGCCAAGCGGCCGTCATCGAGTTGGGATATCATACGCTGCTGGATT
TCCGCACGCTATACCGACCTGGACGCGGGCAAGCACGCTCTTGGCACGGAGCTCCACCGGTCTATGCGCGTAAATCACCGTCG