Description :
From Genome Similarity Track
Location :
Scaffold_531:2805- 6736
Sequence
3931 bases(100 bases per row)
ATTTAATACGTTTTTGAAAATCAAATTGATTAATAGCTGACATATTTTTTATTAGGTCATATTTTTTGGAAAAAACATATTTTCAATCTTATTTATTCAG
ATAAGATAAATTTTATTTTATACAAGGTGTGCGAGTATTTGTGCAAATCCACCGCTAAGCCAAGATACGTTCGAAGTCCTTTTGCATCTAAATGCACCGC
CTAGTCGGTGATCGCCTAGATCTTTTCCGGATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTGAGGCTGGTGTACAATTTATGATCACGAATAAGTGTAAGAACCTTCCGTACGTGGAGTTAGCTGACTTTCACATCCGTCTGTTCGACTGC
ATAGACAGACTAGCTGTCATCCATACGGGACGAAGACCGAATATTGTGCGTTAAATGAACGGGACGATCGAATGATACAAAAATCTTGAAAGACTGTAAT
CGACGAGGAAATAATAAAAGAAGGATAACCTCTTACGTCGATGTATACCACGACGGCAGAGATCTGCTCGCCAAAATGTTGATCGGTCTTGCACCAGAAC
TTGCAACAAATAGGAGATGAATGCTGATTGACGATACTCATATGGGCTATCCGGAAGTCCCAAGTATTAAAGATAAAAAGAAGTTGCAATCACTGGTTTA
CAAGAACGGCCATTAACATGTTGAAAAACATACATCTTACCTAATGGGTCACCTGAAGCGTTTTCGACATAGATGTAAGAGAAATCAATAATACCGCGCA
ATGGGTCCAGCCTGTAGCACCCAAATTATAAAAAAACAGGCCGATCTAGTCAGTGGAATTTATCGCCAAGATTTTCCGAAAATCTGTCGCACCACGGGCT
TCGCTAATGTAGATATCATCAAAATAACGGCGAGCACATACGGCTGTGTATTGATTACAGGTTGGTGATTCAGCTGACAAGATTAATGGTATACCCTATG
CCTCAGAAGTGAAGTATTGCTGGACATAATAAGAGCTATATGGATTTTTTCCTTGATATGACGAGTGGGTTCAGGGTGGTTGAGACGACGGAACTAGCAA
AATCGATCTTATTATCATCACATAGTCGGTTTTGTAGTGATTAAAGATGACTTTTGGGGTGGTGTAGATTTACCAACATTTGATTGATATCGATATGTAC
GATACGTGAAAAATCTTGCAGGGGACTATTTAGTATCTACTGGATCGTCAAAGTCTGTCGATGCACTAACTGAAGGTTTATTAGCCACCGATCTAAGATC
ATCGGTTTTGGGTCAGAGATCGCTTATCGATGACATACTGATAACTTCTGCATTGTGGGATTTCCTATACAAAAAAGTGAAGTAATTGTTCAATTAGTGA
AATGGTTGTAATATTTCGATCATCTGCGCTCAAGGTTTCTAGGGACGTGATAAGGTGTAATAGATAGGGCTTAATGTTTGCTGGCAGGTTTGGAAGCTAA
TCCAAAAATCTGATATTGCTGGTGCGTAACCATTTCCTCGGACGCTACGATTGATGTTGTCAGTTCTTCGAAGTATAAATTACGATAGTAGATTCATTGA
GAACTTTGCAATATATGCGTCCGTGCTGTATAAGATTTTTGAAGCATATTTCCATGACATCAACCCCGCAAGTCATGTCAGACGTCGATCCTTGATCCAG
ACTGGATCGCGATCGCAACTCCCCGAATATATACAAGCCCGATCTCGACTCAAAATAATGGGGATGATTAAGATTCAAAGGGAGGTGATGTTGGCAAAAG
TATGGTATCGCCTCAACGTTTTTTGAAAACAAAGTAGCTAAAATGCTGATTTTGATGCATTTAGATCAGGATCGGCTGCCGGTGATAGTAGTATATGCTA
CTAAGTGGGCACTGTCGGCTGCGTTACTTTTTGAGCACGAAGGTGTATACTAGACGGTCAACTCTCCGATCCTACGCTGACGACTAACCAATTTTTTTAA
TATGGTCAAGAATGNNNCAATAGATTTTCTTCAGATATTGTATATTACTTACACTGTGCTGATGTCACACATGATTGCGATGCATACGTGATCATTACAC
TGGCATGGTTGCTACCATCTGAGTGTCTCAACAGAGATTCGGGAAGGTCGGTATACTTATTTTCAAACTGTACTTAGAGATCTGCCAACCTAAAAAGGGT
AAGATGAGAAACTTGGCATGCTGGATTCAAGTATACATCTCGCGAAGTAGTGAATGAAGTCTTAATAAGGATTATCCCACGAAAGTAGCCTATGGTTTTT
GTCTACTCTGACGGTAGGAGGTGGCATGCTTAAGCAGCCAGGGCAGACAATAAGAATGTCACCTCTTACCCTCAGAGTAGACAAAAACTTCTAGTGGCCC
ATTTTGATAGGTCGTCTAGAATGAAGCAGAATAGTGGGGCAATAAGCAAAATCGTATAGACTTCGTCGGAATATAAGATCGTAGTGGATGCTTCCGTGTA
TACCCCTGATCTGACTATGAAAAAAGCGTAGTACCGAGTATTTCTCCTCTACTTTAACTAGACCGCTGATCAACCAAGGAATTGGTAATTATTTGCGAAT
ACTTCAAACTGAATGATCTTTCAAATGCGAAAATAGATTGACTGCAAAGCACCAGGGTTGAATTTGCTGCATCATACATATGTAAAGAGACTCATTGTGG
CCAATTAATAGGTTTTTACATATGAAGTGGGACTAGTACAAGTGTATAAATTAGCTAGCAAGCGGGGATCTACAGCGAGATAAGAGACTAATCTCTGATC
ATGACCGTCTGGACCTGATCACTCTTAATCAGTTAGGATAACTACTACTACCAGAATGAGTCTATAACTTATTTAATGGGGTCGCAGGTTATCAATCTAT
CCGCATCGAGAAGATGCTGCCAGAACAAGAATTTACAGGAAGCGGTCGTGCAGAAGTATGGATCAATCGTATCATCCAAGAGGAAGACTAATTGCTATAT
AACTTATATTCATTTATATATTTTTGAATGGAGATGTGGCTAGGCTATCGGCGACAGAGACAAACGCTGTACCCTATTCGCACCTAATAATGAGATAAAT
CAAAGTGGATTGCTATATTGATGGAAGAGGTCAGTCACGCAATTGTAATGTCGTGCTTAGGCGGTTAGCTTGATAGGTCCTAAAGTTCCTACAGCGAAAA
TGATTGCACCACTACTATACAAGTCTGGACGGTGGTGGCTGAGGAATTAGCCGCATCCATAATAAATTCTCATTGGACAAGTTTAAACAGAAATGTGCAG
CGGTATGTGGTATAATATGTTGATTTTGATACGGTACACGGATAACTCTATGATCGGAGCGTATCTCCTGATAATTTACAAGCGACATAGCTTTTTAAAG
TATTGGACAACAATCACATTTCTTCATTGCCGCGATCTTTTAAATGGAACATAGAGCTTTTATGGTGCATTAATCGTTTTCTAGGTTTATGATCGTAACA
TCGATTCGTCCAGAAATGCACAATCTCTTGCAAAGAACTGTGAATTATTTTTATTTATACAGATTGGTGGAAGCGAGGCAAGTCCAATTTCTCTCGAGCG
CTAAATTAGGTCTCGGAAAAACGGCGATCCACCATGGTAGGTAAATGGCAAGCCAATGATAAATAAATAAATATGGTGCGGACACTTACNNNNNNNNNNG
ATCAAGAAGCGCGTCAGGGGCGGAAACATAAAGATTAGGACTAATCGGTATTAAGATTTGTTTATACATATAGTTCCCGGAGTATCAAGTGAGTTAGGGA
TAAGCCATTTTGCTTTATTCACGGGTGGTACGTACGCTTGACATTTAAAGCAAACTTTTCGCTAGGATCGGCCTGGCCTTTGAAATTTCGGACCCACGAT
GGTGGCGTATGGCATACAACACCAGTATAAA