Description :
From Genome Similarity Track
Location :
Scaffold_734:2805- 5698
Sequence
2893 bases(100 bases per row)
TTGAAGGCAGGAGATTTATCCGAATTAGTGGTCATTAGACCCGATTTCGAGTTGAACTCGTCCTTATTAATGGATGAGTCGGTCCTAGAGGACACCAAGG
CGGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAAAGATCCTTTGGATCCATTCTATCCTTTGGTAAAGGGATTTCAAGATGTGATGTGTCACAACCC
ACCATCTGTCTTACCTCCCAAGAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATGCTGCGTAACACGGCAGTGGCCTTTACCTAAGGAA
AATTGTGACGTCATTGATGATTTCTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAA
GTCTAATGGTAAGTGGCGGATAGTGCACGCTTATACTAATCTTAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGCTGTTCTTCAGAAC
AATATGGTGGGATGTACATTGCACAGTGCGCTCGACTTAGTCGATGGTTATTACCTGCTGCTCATGCGAGCAGGCGATATTCCGCTAACAGCGGTTAGTA
GTACCCAGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGATGTCAAATGCCCCGGCTACTTTAATCGTCTGGTGACGCAACTATTCAGACCT
CATCGAGGCTATGCACAAACGTACTTTGATGACATATTTGTCCATAGTCGTACAACGAATGGTCGATCTGATGTGAATAATCACATTGATCATTTACGAG
CGGTGCTCGAGTGCACGCGCACGAATAAATTGTATGCAAATGCATTTAAGTGCATCTTTGGGGCAGAAGAGATTCCCTTTCTGGGATGCTTCATTGGGAA
GCGATGCCTTCGAGCGGAACCCGTTAAGATAAGGGCCGTAGTAGATTGGCCGGTTCCAAAGAACCAAAAAAAAGATCTACGTAAGTGTTTGGCCTTGCCA
ATTACTTGCATAAGTATAGTACGAATTACGCAGATATGGATCGGCCATTATCCAATCTTCTTAAGAAGGATGTGGATTGGTGTTGGGGTGACACCGAACA
TGATGCTTTTCAAGCAGTTAAGCAAAGTCTCCTTCATGCTCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTGCGACGCATCTGAC
TTTGCCATAGGCAGTGCTCTGTTACAAATAGATGTCGATGGACGCGAACGAGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAGCTATC
CAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAATCAAATTCAGAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCTATACATTTCATGC
ATCGATGCGCACTGCGACACAGTCGTCGCATCTCTCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTGCCGAATATAACTTCGAAGTGAAGTACAAGCGC
AAAATCCTTTGGCTGACGCGCTATCGCGCCGACCTGTCTATGAGCTTTCTCACGTCACTACGCTGTCATCGTCAGTCACTGGCTTAATCCGTGCGGCTTA
TGCTAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTTGGATCGAGGAGTTTACAGACTCGGACATAGAAATGTCGGCACGTTTACGTGCGAGGCTA
CATCGATATTCTATCGATAATGGCCTGTTGTGATATCGCACAGATATTGAGGATAACCCTCGTATCGCTTTCCCTCATGATGAGGAGTTGAAGTATCGAA
TCCTCTATGAGGCACGTGATACCACTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAA
GTGGGATATCACCTATGTGCGTACGTGTGAAACGTATCAACGGGTGAAACTCTCAGCACATGCGGCAGCACCGCTGGCTAGTCTTCCTGTACCCACTGGG
TGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGTCCTAGCGAAAGAATCGGAAAGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGT
CTCATCTAGCGGCAGTGACGGAATCTATTGATGCCGAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTTGACAACATGGTTTGCCAGTGGCAATTGT
CTCTGACAGAGATCCCCGCTTCACTGGGAAGTTTTGGAATTCCATCTTCAAGGTGCTCAGTACCCGTTTGGACATGTCCACAGCGGATCATCCGCAGACC
TATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGCCATTTGCGCAGTGTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCCCTGTTGTTGA
GTTTGCGTTGAACAACGCTTTTCGCGCCTCTACAGGCTATACTCTGTTCTACGTGAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGT
GGTTCAGGGCTTGTTGGGGGAGAGGTTACCGATCGGATTGCTGATATCAGCCCTGCTGCTGTTCAAAAACAGGTAGGCGAGTTTCTCGCAACGCGTTTGA
AAGTCTTAAGACATGTGCGTGACGCAATGGCTGAAAGTCAAGACCAACAAAAACAACAAGCAGATGCTAAAAACAGAGTTTGTATTGAGCGTTATAAGGT
CGGAGACCAAGTATTACTCAATGCTAAAAACCTACCCACAAATGTAGTGTCCGCTGTCTTTAAGACAAAGTTGCGTCCACGCTTCATTGGACCATTTACG
GTCACTGCCAAGAAGGGACGTGCGTATACGCTAAACCTTCCGCGCAAATTGTGCACACACCCAGTGTTCTACGTAGGCTTACTTAAGCCATAC