Description :
From Genome Similarity Track
Location :
Scaffold_1:2804323- 2839162
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00732hypothetical protein
Phypa_INRA-310PPTG_00733hypothetical protein
Phypa_INRA-310PPTG_00734hypothetical protein
Phypa_INRA-310PPTG_00735hypothetical protein
Phypa_INRA-310PPTG_00736HECT ubiquitin ligase
Phypa_INRA-310PPTG_00737HECT ubiquitin ligase
Phypa_INRA-310PPTG_00738hypothetical protein
Phypa_INRA-310PPTG_00739hypothetical protein
Phypa_INRA-310PPTG_00740hypothetical protein
Phypa_INRA-310PPTG_00741amino-acid acetyltransferase
Phypa_INRA-310PPTG_00742hypothetical protein
Phypa_INRA-310PPTG_00743hypothetical protein
Phypa_INRA-310PPTG_00744hypothetical protein
Phypa_INRA-310PPTG_00745hypothetical protein
Phypa_INRA-310PPTG_00746cGMP 3',5'-cyclic phosphodiesterase subunit delta
Phypa_INRA-310PPTG_00747nardilysin
Phypa_INRA-310PPTG_00748hypothetical protein

Sequence
34839 bases(100 bases per row)
TGGTTCTACAGAAAGAGAAACTTGAGGAGTTGGCTTCAGCTGAGGGAGTCGATCTACTCTACGACTACTGCATTCGTGAGAAGAAAACGTACGCAGAAGT
TCTCACAGACTTTCCTAGCGTGGACGTGCATTTGACGATTCTGCTGCAGCTGATTCCTCGTCAAAAGCCCCGATCGTACTCCATCTCATCATCGGCTTTG
CTGCATCCAGGACGCGTAAGCTACTTATCCAGTACGGATATTGTGCTGATACTTACATCCCACGTCTTTGGTTCATAGGTGCATTTAACTGTGGCCATTG
TGGACTTCTTGACGCCATACAAGCGTCGCCGTAGCGGCATTTGCTCGTCCTTCTTCCTATCTCTGGATCCATCCAAAGAGCAGAAGCGTGTGCCGATGTG
GATTAAGAAGGGCCTCTTTGAGCCGCTGAGCTTAGATCGTGACGTGCTACTCATCGGTCCTGGCACAGGACTCGCCAGCATGCGGGCTATGGTGCAAGAG
CGTCAATTCCTGCGCAAGCAAGCAGATAAAGACAGCAGCTCTGGAGCGGTGTACCTCTACTTCGGATGCCGTCATGAAAGCAAGGTAAAAACCTTACAAC
GGTCTTGAAACGCACCAACCACCTAACGATTTACTACTGTATAGGACTTTTTGTATGGTGACGAGCTACGTGGCCTCGTGGCCTCAGGTGATATCACTGA
GCTACACACCGCGTTCTCGCGTGATCAGGTACCTCAACACTTCAGCTCTTGGAACATGTATGCGGTGTCTAAGTTCGTCATATCTTGCAGGACCACAAAA
TTTACGTGCAGACGCGTCTAGCAGAAAACAAGGAGACCATCTTCGATTTTATCATGAACGGCGAGGGATGCATCTATATCGCCGGATCCGCCAAGCGAAT
GCCTACTGATGTCTATGAAGTGCTGCGCGACATTCTTCGATCAGTAGGAAAAATCCCATTACCAACCGCTGAGAAAGTGATGAAGACGTTGGCCCGCAAG
AAACGCTACGTCGTAGAATCATGGTCGTAGACATATCGAGACGAACCGAGGCCTGTAAATCCCGCAGTATAGAACACTGTTAAAACTTGATTCCGCTATG
ACTTCATTATGACTCCAATATGATAAATTTTATTAATTAGTAGTAAAAGCATATACAAAAAAAAACTTTCGGATAATATCCTATATAATCCGACGGATAT
GAACGATGCGAAAACAGCGCAGCATGTGCGGATGTTCGTGAAGCTCGCGAACGTCACACAGACATCGCAGCTGCACGAGTGGAACCTTGAGTCTCTTCAG
AGAGCTCTGGAATGGGCCTGTGCAGCTGAAGATGCCGTGAGTGAGGGTGAGTCGCAGCAGGACGTTGAGACGCGTATCCGTCAGTGGTTTCCAGTCGCCA
CTCTTCCCACGCTGCCGCTAGATGGAGCTCTGACAGCGGAGGCTCTACGGCTCGCAAGGGTTCATTTACTGCGGTCAATTCTACAGAGTCCGTTCCTAGC
GTCACATCCGACACGGTCAGAACTGCTGGTCACGGTGCTTCAGGAGCTAGAAAGGAGACGTGAAGGCGCTTCAATTGATGAATTGGAAGAGCATTCACCC
AATAGGTGACACGATGATGAGGCTGCTTTGTGGAGTGGTGCAGCTGTAGGATACTTATCCTGTGTTTTGGATATTGTTTAATGATCTGATAGTGCGCTGC
TGACTGAAGGAGTCGTCGGAGCTTCGCGCACGAATGCCATGCTGGCCATTGCACGCAGAATGAGCGAAAGATGCAAACGCGTTCGTGTGCAAGGTAGCTT
TTGCTTTACTATTCACAATGTAAATACCAAATGCTGACGCGTTGGTATGTTTAGTGCTTTCCGGGTGGGTATTGGTGGCCCCACTTAAGAGCTACGCACT
CTCGCCGCGCACGCTTCAGCTGAAGGCAATGGCCAAGACATTGCAGCGAAATGCAGTGGATGCTCGGGCTGCAGTAAATCCGGAAACATACCACTGCTTT
CTGAATGACTTGCAAGGCTGCTTTGAAGCACCTGACAGTAAAGATGTCCGGGTAAGCGTTTAAGAGATACCTGGTCTTTACTTAGGCTGACGCTGAGCAT
ACCTTTGTGCAGGAAGTTGTAGTGCTGATGCTGGTCATGTGTGAGTGGCCCAAGGAAGAGCCCCCGCAACTTCAGGGAATGATGGAAGATCTTGTAAAAC
TCGTGAGTGGCTGGGTAACGCGCAAGCCTATTCGGTTATGGGTGTTCCATCCTTGGTTGGCTGCCATGTTGGCAAGTAAATCGCAAGCTATCGCAAGCGC
TTATGTATCCGAACTGTTCAAGACGGGACTCTTACAACCATGTACGACTTTACATGAGCCTTGTCCTATTCGTGTGGATACGCATTAATATTGTTTGCAT
CCAGGGGAGCGAGAGTTTGTAGAGCGTGTAGCAACGCTTGTCTTGCAGCCAGAAGGCGTGGAGGACGTATTGAAACCAGCGCTAACAAAGCTGGACCCCC
ATTTACAGCACGTCTACTTCAACGTGAACTTAAAACCCGATCGTTCATAAAGACCACGCTACGCTCAAGTATTTAGGACCGTCTTGGTATTAATGTGCAT
ACCGGCGCAAAACATTGACGACTTCATGATGACCTTTGCGCAGTGCTAGATCTGTAGCAGTGAGGTGAGGCACTTCCAGAAGCGGTAGTGTTGTATCAGC
GCCACCTTCGTCGATTAACGCGACGCAACACTCGGTGAACCCCTCTTCTCCAGCGATCACCAGGGCGGTGAATCCAAAACGATTTCGCTGGTTAACCAGT
GTTCGAGTCCATTCTTCATCGAGGAACGAGGACTGACGAAGATGCCGTAACATCAGTTGCAACGAGGTTACCGCGTTCGCCGCTGTAGCGAGATGTAGAA
TTGAGTTTCCATCGGCATCCGTCACGAGGACACCCGCTCCATGCCTACAGCCACAGTTAATCTTTAATATGAACTGGAATCTTACATTGTGATCTTAGAC
TTACTCAAGAAGAAAGCTGACAACGTCGTGGGCGTCCCAAGCGGATGCATGCAGCAATGCTGTGCGACCAGTATGAGGGTGCCGTACGTCCAACAGAGTT
GAATTGCTACTCTGTAAACAGCTTACAGCTTCTACATCGTTGTCTCCAGCGGCTTGCATCCATCTATTCAATAACTCCATTTACGTGATAGTAGAAGTTA
AGGCGAGTAGTCGCGTACATCTGATGATCAAGTAAATTTGTTTAGCTCTACTGGTCATTGTCTTGAATTGTCAGCTCACATTACGCTCCTACACAATGTC
TGCTGTAGTTTTGACGGATCAGTCCGTAGTAAAGCCATAGACTTCTGTTTCCAGCGTAGCATATAGCACAGCCTTCAATTCATCACGAACAACGTGAAGT
GGCAGGTCTAGCCGGTTGAAGCAAGCATGACTGTGGATGAAGCCATCACCTACCAGTGACACTGCCTTCAGAGTAAATGGACATAAGCGACCATCGTAAC
TCGTCAACGCACTAAACCCACCGAGAGGTACACGTGATGAACCAGTGGAGAACTGTAGCAATCGGCGACGATATTCATTTGGCATCTCGCGCACCAACTC
CCAAAACCAAATCAATGAACGATGGTGGTGCAGTTCTTCCGAATATTTCGTATTGCGTTCCCAGTCATCGACGTCAATCTCATCAGATCCGCACAACAGG
AAGTCAAACTCCTCCGGATCGAATAGTAGCAACAGCTCACGTGGAACGATTTCGTACAAGCCACAAAGAAAGACTTGTAATTGTGGTGCCACGCTCTCCA
CTAGAAGGTACTGCCACTTCCGCTCAACATACTCGCGCTTGTTGCTGTCGGTGACTGCGATGGAGCTACCACCAGGGACGAGCTCGACATCACGATACTT
CTCTTCTTCCTTGACTGTCACGGTGAAGTACAGTCCAATTGACTCGACGTTCTCATTGTCTAACAGCCAACGTAGATTTGTGTACACTTCTGGGTCCAGG
TCCTCTACATCGGCGAAACTTAGTGGATAACCAAGCATGAGTTTAAGCAGAGGAGGCGCAAGATGAAAGCATAGCATAGAGCCTTCGAGCAATGCGCGAC
CCAGTAGTCGACCGGTTGCATACAGATGTAGTAGCTGGTCCGGTAAGGAATTTGCAGTGAAGCAGGGATTCAAAAAGTAGGTTTGCTCGTTCTCGTTGGT
GCATACAAATAATCCACGGGCAGGATCTACCAGCATTTCATTCAGAAGCACAAACCATTCACGGTGCAATCCACCAGCGTCAACACCACTCTCATCCAGG
AAATTAATGCGCAGGACAGAGTGCACATTCTGAAGTGGAATAATAGCCAGAGACTCCATCGAGTCTTCAAACACATTTGCCCGCTCTACGTTGAGCCGCA
AGTGCTCTTTCTCTGCTGGAATAAGCAGCGCCGACGTTGCAGTGACGAAATGAGCGTATTTTGACGGGAAATCTTTTGCAGCAAGTGCCATTATCTCGGT
TAGAGGCGTTGAAGCATTATCCTCTGTGGACGTAGAATTACCGAGAGGCAGCTTTGAAGCATCAACGGTCGTATCAGTCGATGGAGTAAGCACAACGTGC
TGCTCTTGTGTACCCCGTATTAAGGTGGCAATGCAACCGTCAATCGATCCAACCAAAGGTTGCTGGGTACTATCTTGCTCGACGCTCTCAGTATTCACCT
CTGCACTGACCGGGTTCGGGTCGGGGGTATCCATTTTAACAGAAGACGCAACCGTCACAACATCAGTTCCACATTCTGAAGGCGGTAGTGACGATTCTCC
TTCTCCGACGGCGTTAGGCAACAGCTTTTCCATGCCGTTGTCAGCCATTGCTGGCGTGGACTGAAACTTTACAACGAATCCGGTAAACTGCGTATCACCC
CATCGACCATCTCTGAACCAGAACGCACAGCCTGCAACGTCTATTTTCCTCGTCCACTCTTTGCGTCGCTGAGCTCGTAGACGACGCCGAGTTGTTTGCT
CTGGAGGCGTCACAGTGACCAACTCCACTTTGGTTTCACGTTTAAGCAGCGGTAAAAATGAGAGCCGTGTCGATCGTTTTTTGCTGATATTCATATCACG
ATCTCCATCCTGTTCGTCACTGACAATGGCTTCTCCACAGACTGTACAGAACTTGAAGCGCTTGAAATTCTCAAAGCTGCATACCGTACATTCATTGAAA
CCTTGTTCGGCATCCCTCAGTGCTGCGTCCAGACGGCGATCATCCGAGCTGTAGAAATTGCACCAAAAAGTTACAATAGCGTTAGTCGAATAGTACTCAA
TCGAAGCCTGTGACTTGTGACGTACTTGAGCAGCGGTGCATGCAGCTCCAGCGAGCGCTGTCGGCGGATATACGCGCGCCTGGCCAGCATACTCAGGAAG
AAGAAGAGCAACGCGATGATGGCCAGTACCACGAGGAAGCCCAGTACGGCCTCCATGGCTCTTGCGGTCTCTGTCGAATCTACGAGTGGCAGTGGCAATG
GCGTTTGTCACGTAAGGCCACAAAAGTGCTTACCATAGGTACAGTTTACATAGGATAAGAAAGATAATTAGAAATCGAAGGTAAACTTTTGTGGTTACAT
TTGGCGGTACAGCAGATGAGTGTGCACCTTTTCGGACGGTACACGAGTAAGTTGACACGATTACTCGACGCCTACCAGGCTGGTAACCAGCTTGCTTGGT
TCCAGTCGAGTCACCACCTACACTAACAAATTGCAATTTAGAGCACGATTCTACTTTATTCAATTGGCAAATTGAGAATATTATCAGTCCGTCGTGAAGC
CATAGGCCTCTGTCTCCAGTATGGCGTGCAGTACAGCCTTCAGCTCATCTCGGGTCACGTGAAGCGGTAAATCCAACCGATTAAAACAAGCATGACTGTG
AATAAAGCCGCCTCCGACGAGCGGCACAACTTTCAGTGTGAATGGGCATAGACGACCGTCATAGCTTGTCAACGCGCCGAAACCACCGAGCGGTACACGT
GACGACCCTGTCGCGAACTGCAGCAATCGACGGCGATATTCGTTCGGCATCTCGTGTACAAGTTCCCAGAACCACTTGAGAACTCGAGTGTGATGAAGCC
CTTCTGAATATTTGGTATTGCGCTCCCAATCGTCCACATCGATTTCTTCAGAACCACATAACAAAAAGTCGAATTCCTCCGGATCAAAGAGCAAAAGGAG
TTCGCGAGGAATGATTTCGTAAATCCCCCGAAGAAAAACTTGTAGCTGGGGTGCTATACTCTCCACTAATAAGTATTGCCACTTGCGTTCCACATACTCA
TGTTTGTTGCTGTCGGAGACGGCGAGATTCTTTCCACCGGGTACGAGTTGAATCGTGTGGTATGTGTCTCCATCCTTGGCGGTGACAGTAAAGTCGATCC
CTAATGAGTCCACATTATCATTGTCCAGAAGCCACCGCAAATTACTGTACATTTCAGGATCCAAATCCTCCAAATCCGAAAAACTCAATGGATAACCCAA
GATCAGCTTCAGAAGTGGTGGAGCTAAGTGAAAGCACAGCATTGATCCCTCTAGCAAAGCTCGTCCAAGTAAACGACCAGCTGCTAAGAGGTGGAATAGC
TGGCGAGGGAGATCATCCACGTTCGAGCACGGTCTTAAAAAGTAGGTCTGCTCGCTCTTGTTGGTGCACACAAAGAGTCCATGTGCTGGATCCACTAGCG
CCTCGTTGAGCATAACGAACCATTCACGTTGAAGCCCTCCAGCATCGATACCGTTCTCGTCAATGAAGTTTATACGCATTACAGAATGTAAATTTCGAAG
CGGAATAACAGCGAGAGATTCCATCGAATCCATGAACACCTTTGCACGTTCGACATTAAGTCGTAGGTGTTCTTTATCAACAGGAACCAATAGGCTTGAA
GCACTCATTACAAAGTGTGCATACTTGGAGGGGAAGTCTCGTTTGGCGAATGCCATGAATTCTGTAACAGATTTCGGCGTTTCAGTAGTTTCTGGGATGT
CGTCTTCAGTCGGATACGATGCCGTAAGCTTTGGACCGATTGAGATAGTGAGGGGTAGTTTTGAGGCATCCACGGCAATATCGGAAGTTGGTACAAGCAC
CAATTCCAATTTCTGTACGGACTTCTTCAAACTCGCCATGCGCCGCTCAAGGGGTCTTAACGTAGGTTTCTGACGCGTTTGGTTACCATCTCCAAGACCT
GATTCGGGTTCGGGAGTGCTGGGAATACTTGAAGCACTATCTTCATGGTGTGGTGAATGCGTTGGCGACGTTATTTTATCATCTTTCGATTGATCTTGAC
TTGTGGGTGTGGTAGGTGGTAATCTTTTGGAGTCCTGGGTGTTGGGGAGTAGTTGAGACCAAAAACACTTGTCAATGACGGGACCTGTACTTGCACGCTC
AAACTTTGCAACAAATGCCGCGGGAGGTGCGTCAGTCTTAACTAAGCGGCTATCACGAAACCAGTACATTCGGCCTTCGACGTCCTGCTTGCGCGTCCAC
TCCTTTCGTCTCTGAGCGCGTACACGACGGCGAGTGGCATGATTCGTGAGTGTCGAGATAGATGCAGATGCGGCAAGCTGCACATCACTTTCACGTCGGA
ATATTGACAATAGTGAGAGCTTCACTGGTGTTTTCTTCTTTTCTGCGGCGCCTTCACTGTCTCCTTCGTCGTCCCTTTTCCTCATCAGCTCCCCACAAAT
CGCACAAAATTGACAACGTTTGAAGTTCTCAAACTCACAGACTGCGCACTTATTAAATCCTTCTTCAGCATCTCTTCACAGCCAAATAATATAACAAACT
GTCAGCTCTGCCTTTGCAGTCACGACACCATTGGAACAGAAACCAACCTCAACGCTGCATCCAGACGTCTATGGTCTGAGCTGCACTCATCACAACACAC
AAGCAAGAGACAACATAACCATTAGACATCACCGATACAAGCAAGGTAATTGAGCAGTACCATTGTCCATTGACCAGTGACGTACTCGATGAGCGGCGCG
TTGAGCTCTGCCTCACGCTCGAATTTCTTGAACGAACGGCGTGCCAACCAGCCAAAGCACATGGCAAGGAGCAGTGTTAGCGCGCACGCTACGGCGATGG
TCCCGCCCACGGACATTGCTCAGCAATGCTCACGGACTTGGCTGTGAGATTGAGAAGGGTGTACGAGTTGGAGAGTGCCACGATGAGGTCATCTCGATAT
CTGGTTCCGATACGAGCCATGCAATCAGGTGTCAATTACATTCACGATAAAAGGCAAAAGTGTTTACGTTAGCCAAGCACAATTTGACAATGCAATTGCA
TCAAACACGTACGAAAACTTATGGGCCTTGCTGGGCATGTGGTGCGTGCAAAAGTGGGATCCCAAATCTGAGGACCGCAACCACGATCGCAAGAACGGCA
CTCGTCTCCATCGGCATTAGGAACTTCCTAATAGGAAGAAGGTTGGAACCTAAGTTGGAACAGTTTACAAACGTATTACTCAATTTGAAGGTCGACCGCA
AATGCCGTGTCCGCAGTGATTCTCAGCGATATCCAGAAAGTTACAAAAAATCTCAAAATTATTATAGCAGCAATTGAGCTGTTTACAGTAGGTTTGCTCT
TTGGCATCCCTCGATAACGTAGATACATTGCGACGCCCAATGGCGCCGAGCTTGGGTTATGCCGTCGTAAAACCCGTGAGATCGGTCTCCAGCGTGGCGT
ACAGCATTGTCTTCAACTCCTTCTTGCTGCTATACAAGGGCAAATCCAACCGGTTAAAGCATGCGTGACTCGAAATGTACTGCGTCATTTTGTACGACAC
ACCCTTGAGGTTGAACGGGCATAGGCGGCCATCGTAACTAGTTAAACCACGGAAACCCGAAAGTGGAACGCACGCTGATCCCGTCGCGAACAACAGAAGA
CGCCGGCGGTATTCGTTCGGCATTTGACGAACGATCTCCCAGAACCATCGGGTCACGTTAGCACCTTCGAGATTTGGGGACATAACGGTGTGTGCCTCCC
AGTCCGTGACGTCGATTTCCGGGGATCCACATAGCAAGTAATCAAATTCTTCTGGGTCGAAGATCAACAGCATCTCACGAGGAATAACCTCGTACAAACC
TTTGAGGAACGCATGCATCTGATCGGCAACACTCTCGAACAACACGTATCGGAAGCGACGATCCAAATATTCGCGCTTGTTGGCGTCCGTGACGGCGATA
TTCCTTCCATTCGGGATCAGATCCACCACGATCTTCTCGGATTCATTTATCTGCTCGGTTAGACTGAAGTCAAGTCCGAGATCGTCCACGCCGTCATTGT
CCATCAGCCAACGTAGGCTACGATAAGTCTCAGGGTCCAGGAACTCCATGTCGGCGAAAGTCACTGGGACACCCAAGATCACCTTCAGCAATGGTAGCGC
GAGATGGAAACCCCAGATACCACCTTCCAGTAATGCACGACCAATCAAACGTCCAGTGGCGAAGTAGTAGGCAAGGTGGTCTTCACCCACCTCTGCGGAG
GACTGCGGGTTGAAATAGTAGCTCTGGTCAGCCTTGTTCGTACACGTAAAGAGTCGTAGCGTCGGTGAAGCCAGCAGCTCGTTCACCAGCATAAACCATT
CACGGTGGACACCACCAGCGTCCACGCCACTTTCATCCAAGAAATTGATACGCATAAAGGAGCGCAGATTTTTCGGTTGAATGCAGTACATGTGATCCAT
TGACTCCTCCATCATGTAGTCGCGGTGTACCGACAACTTCAGAAATTCCACCTCCGCAGGCACAATTAGGGACGCAGTGCTCACTACAAAGTGCGCATAC
TTGGAAGGAAAGTCACTAGCCGCCATAGACACAGTCTCCTTGCGACGCTCTGGACCAGCATCGCCAAGTGTCGACTTGCCTGTAGGGAATTCCGCTGGGT
CAGAACCTGAAGCCTCAATCAGCTCCACTTTTACGTCTGTAGGCAATATCGGTTTTTCTAGAATGTCTTCCTTGACCTCCCGTGGCTGTTCCACAGCGAG
AACCGGTTCATTATCAGGGGTTGTCTCCTCATCCTGCTCCTGGTCTTCGTTCGTCTCCTTCTCCAGCTCTGGCTCTTCTTCCTCTGGGAACTTGAAACTC
AACGTGTAACCAGGCATGAGTGTGTCCAACTCGTTACTTACCGGCACGTTTCCACCGCCACTTCGGTACCAGAAGAGATTTCCTTCCACGTCCAACTTCC
TACTCCATTCGCGACGGTTCCTGGCGCGCCGTTGCTGGCGACTCAACGACGACATTTTCCTTGGTCTGGGTGACATCAGATGCGCCGGTTGGTCCGCATT
CATTACAATGCTCATGGCTCCTCCTCTGCTCGAGTTGCTCTCAGCACGTCGAAGTTGATGCTGCTGTTCCTCCTCGTCGCTCTCGTCGTCGGCCGTCACC
ATGGATAGCGACGGCAGTTTGTCGCCACACAAAACGCAGTAATCGAAGCGCTTGAAGTTCTCGAACTCGCAGCTGGCGCATACGCTATAGCCAGCCTCTG
CTTCTCTAGTGGCGGCATCTATTCGATGATCGACCGACTCGCCTGACAGCAGCGGGACCTCCATGTCGAGAAGGTGACGATTGCGTCGACACGCCATAAG
CCACACCACAAAGAAGATGATGCACAGCAGCAGCATACCGATGCCCTGGTACAGCATCGACGCCTCCGTCGAGCGCTCATTGTCCATGTTTCACTCCGCG
TCCTTGAGGTTTGTGCGGCCTCGAAGTCCTACGTTGTGGAATGACAGTCACAAGGATTGACCAGAGCCAGCGTGACTGCATTTCAGTATGGAACCACGCC
CCGGCTTTGCATCGGATTCACTCGGATGTGGATTACGCCTTCATTTAACCCTCGTTAGAGTGACAATCCAGCACAAGAAAAATATTGAATTGTAATTAGT
CAGTAAAGTGAAAGTTCAACTTGTTCATTTGTATCACAGGTACTGCAAGTAGCGTATGGCAAAATACTTCCCATAAGCAACTGTAACATTAGTGCTCGTC
GGGTGGTTTTACTTCGGGGCTGCAGGGGGCGTGTTTGGTGGCCGTGGCTCAGTGTCGAGCAAACTCGGGCTCCACAATATGCAAATCCAACAACCATCCA
ATCGCCTCGGGTTTTGTGTTCCATGGTCGGACAAACACAAGTTTACCGACGCAGTAAACGTTACAACCACGTGCAATAGAGACTTTCCACTTCGTCATCG
TTAAATAGACGACGCCCAAGCAGCTTTCTCCAGACAGCTTCAACATCGAATTGAGAACGCTATTGTTGCTTTGGTTGGTTTGTGTTACATAACATAACCT
TAATCTACGGCCCTTGTGATCCGCATCTTGTTGCCTTCGAGACGTTGGTAGCAACTGCTGTCAGCAATTTGCTGATGCCTTTTTTCCGTCGCGTTTACGG
CGCAAACTGTCCGTAGGAATTCTACAGGATATCCAGTGACGCTCAGTCTCGATTGGTGGGGAAAAGTAATCAATTGTAACCCCCCAATGTGGACACTTGT
GTGGAGGCTAGAATGTTGTACCTTCGCAGCATGCCCTCGCGGAATAGTTTGTTTACTTCCGTTGGATCTATAGTTGACAATACGTTTACTACGCTGTCGT
GAACCCGTACGTCTCAGTGTTGAGTGTTGCATACAGCACTTCCTTGAGCTGCGCTCGAGACGATACCAACGGCAAGTCCAACCGGTTGAAGCACGAGTGA
CTTCGAATGTAAGGCGAATGCACTCCCTTCAACGTAAATGGGCAAATCTGTCCGTCGTGGCTTGTCAGGTACCGGAATCCCCCGATCGGTACTCTTGAGC
ATCCCGTTGCAAACTGCAGCAATCGACGGCGACATTCCGAGTGCATATCTCGAACCAATCCCCAGAACCATCGAAGAATTCTTGTCCCTGTGAGATTCCT
GGAGCATCTTGTATGCGCTTCCCAATCCGTCACATCAATCGAGTCGCAACCACAGAGTATGTAGTCTAGTTCTTCCGCGTCAAAGAGCATGAAAACCTCT
CTCGGAATCACTTGATACAGTCCCTTTAAGAACACGTACAACTGATCAGAAACGCATTCGAGTAAAAAATATTGAAGCCAGCGCTCTGCGAACTCATGCT
TGTTCTCGTCAGTCACAGATATATCGTCACCATTGGGCACCAGCTTTACTGTTACCAGGTTGCCAACTGCATCTTTCCTCGTTGCAGTAAAGTCTAAACC
GAGCTTATCAGCCCCCTCGTGCTCCAGCATCCACTTCAAGCTCTTGTACGTCACCGGATCAAAACTTTCGAAATCGTGAAAAGTGATAGGAACACCAAGG
ATAGTCTTAAGCAGTGCCGGTGCAAAGTGGAATCCGATCACTTCACCCTCTAATAGTGCACGCCCGATAAGCCGTCCAAAGGCGAAGAAGTAATATGCTA
AATGTTCCTCACCGATCCACTGCTTCGAGCTCACATTGAAGAAATACGTCTGGGTCTCGTGGTTTGTACAGACGAAGACACCCAAACAAGGATTGATAAC
CAGCTCCGTAACGAGACTAAACCATTCACGGTGTACACCACCCGCATCAACTCCAGTCTCTGCTGCAAAATCTATCCGAACCACTGCACGAGTATCATTA
TCATCCAAACAGCAAAAATACTCCATCGATTCTTCGACAACATGTTCGCGACGTAGGAAAAGCTTCAACACCTCCAGCTCAGCCGGCACAATTAACGAAG
AGGTGTAGGCAACGAAATGCGCGAATTTAGTCGGGAAGTCTTCTTTGGACAAATCTATTAGTTCCTTGATGTCGACGGTCCTTGACGAAGCTGATCCCGT
CGCAAATTCGAGCGCATCCGCATCTTCACCAGATAATATCTCCAATTTTACCATCCCATTCTCGTTTCGCAGATTCAAAATTATTGAACCAGGCTCTCCA
TTATGTAGGACTACCGCCAGCTCTCCGTCCTCACGCTCTTCCTCTTCCTTGTGAAACATTGCAACATATCCAGGATACTGGAAACAATCATGATCGTAGT
CTCGATGCCACGATACTTTCTCACATCTGAGCTTCCGCTGCCATTCATTCCGACGTCTGTTCAATCAGCACAGAGTAATTATGAAAACACCGCTCAATTA
CTATGCAGCAGTGGAAATTCGTTGTCCAGCCCACCTTACACGTAGCTGGCGAGCTGTGAGAGGACTCCGCGCCCGTACTCGCTCTGTTGGCGATAACTTG
AGCTTTTCGCCACATAACACACAGAATTTGAACTGTTGAGTATTTGCAAAAGCGCACACCCGGCACCTCACGATTTCTTCCTCTGCATCGCTACATGTAG
ACAAAATACAACACCAAGTAAGTCACCTGCCTCTCTTCCATATTGCCGTCTTTATCCGCTTACTGCGCTCACATACAGCTTAGCAATGTCGACACGATGC
TCGCCTGTCGTCTCCTCCCTGTAGAATTCACAACAAACCTGGTCAAAACTCACAGAGAATGTGCGTTCATTAGACACAAAAAGAAATCTGAACAAGCCGC
CACCTGGCAATCAGCGCCTGCTGCAACTCGCTGGCACTGCGCTCGTAGTTTTTACACCGCAGCGCGCGGAACATGTAGGCGACGAGCAAATACATCGCCA
CCTGGGAGACCAAGATGGTCACCAGCAGCGCGTCCGCCATCTTGTCTTCAACTGAGCGTCATCATCAATATGAAGTCACTAAAATGACAATAGTCACTAT
CACGCGGTAATTTAAATTTGCAGATACACTTTCAGCATGAGCTCCTTGAGCGACAAGAGCGCGTTAGTGCTGGAGCTGGGGGCACGTTATGCGCGCTGCG
GCGTCTCTGGGGAGCGAACGCCTCGGTGTGTGGAGAGATGGCAGGTTCGTCCGCATCTTATCGCCGTAATTGGCTTCAGGATGGCTAATATAATGCGGAT
GCAGGTGGGGGAAATGCTTCAGAAACCGCTGAGCGCAGCCGAGTGGCGCCAATATCTGTACCCGAAGCTACACTGTTTGTGTTTTGAGTGGGTGTGGTGC
ATACTCTATTGAATGTATTCCGTAGATGACTTATACGGCAAACAACAGGCGGCTGCTGGTGAATCCGGCGCGACGGCGCTTTGTGGTGTGCGAGGATCTG
CTGCTGCCGCGTGTGTTTCGAGAGACACTGCTCAACATCCTCTTCGATGTCCTTCAGGTGGGGTCGAAAAGATTTGTCAGTGGATGTATAGTAGGGCTAA
TAGGATGGGTTTGCTGTTGTTTAGGTTTCGGCGGTAACGCTGGTGCCGTCGATGATGGCGGTTCTGTACGCTACGGCCAATCACACCGCGTTGGTGGTGG
ACTGCGGCTGGGCTGAGGCGAGATTGTTGCCTGTGTTTAAAGGGGTTCCTCTGCCGTATCTTTATGAGAGTGAGCAGTGGTCACATCGTTGTGGTAGAAT
AGTTGATCGGGGACTAACCGATGCGTTGGTTGATTGTGCTGTGCCGTAGCTGTCCCTGTTGGCAGTCGGAATTGCTGCGAAGTTATTCAACGAGAGCTAA
ATTCATCTCGCGACCAGCCGATGGACAGTTCGAAGATTGTCACGCCGGTGACTGAAGCAATGGCAGAGGATATTCTCGAGCGAGCCTGCTTTGCCCAACA
AAAGGTGAAGCAAAACAAACTATCATTCAGCCATGTCATTGCACTAAGCTAAGCTTTTGCATGATATAGGATCCATTGCCCAACATTGTTTACGCTGAGT
TTCAGACAGACGACGACGACGTACTAAAGGTTGTCGATAAAGCGCTAGCAAACGCGCTGTGCAAGACTTGACTAATAGTATCGCTTGCTTGACAGGTTCC
TGGAAATCTTCGCACTGATGCAGTGGAACAGCTACTTCTTGGTACGTTGTTTATATTGAAGTAGTAGTGGGAAGATACACTTCTAACAGCGTCTTTAATA
ACCAGGTGACGAAGGCACGGATGGGACATCCATTGTTGACGGCATCGTCCAGGTTTTGAAGAAGGCCCCACTTGATGTGAGAGCGGCAATGCTGGAAAAT
GTACTCTTGGTTGGAGGAACTGCAATGATTCCTGGTACGATTGACGCTTGGAACAGATTGTTGCAATGTTTTTTAATGCTAACGGGCAATGTGTTCAGGC
TTGGCACAACGCGTGGTGGATGAAGTGCGTGAGGCTTTGCACCACGACAACGAATTTGCTTCTGCTTCAGCTGCTGTCGATCGAGCCCAGCTCGTTCAGA
CCTACTTCCCTCGGAACATGCTTGCATGGGTCGGTGGCTCAGTTTATGCTGCCACGGAAAGCGCTCGTGTCTCGGCTATTTCGTCGCAAGAATACAATAG
TTCCAAAGGTACCAGTGTCCCTGATTGGCTCACTGTCGCTGATGAGGAGTTCTAGACTTGCTGGTGAGTAAATGTTACTGCAGTATCAACATAACCAGAA
GAGGTACAAATTTGATGGTCAAGCTAGTATTTTCTTCATTCATAAGCTCTGCGATCTAGCAGTTAACACTCTCGTGTTCTTTGTTACTTGCTGGTCCGCA
TTCCAAGTGGCTTACCAGTTTCGTCCCATGGAGCTTTCATACCGAGATCGGGCATACCTTTGAGGGTAGTAGCTGCACCACTGGGCCGCTTGAGTGGAGC
AACATGATGCGGCAGTGCCGACTTGCGTGGCTGCATCTCCTTCGCCGCTTTGGAGTCTGATACAGCCTTGACACCTTCCTCGCGTCTGTGCTCCTCCTTG
GCATCAGCTTGGAGCTGGCCCTTGTTGCGTGACGTGATACAGTCGACGGCTGCGGCGTCCTCGTCTTCTTCCTCGTCGGTGAATTCATTCTCAATCTTCC
ACAGGCTAATACGTCGCAGTTCTTCGCAACCACGAACTCCTTTTCGGTAAGTTTTGAGTTGAATGCCCTCCTTCTGCAGCGAGACGTCAGGGAAATTCGT
GTCCAGCAAAGGTTGTTCTTCTTCCCCATTCTCAAGATAGACGTAGAAAGTGAAGTCGTAGTAAAGCAGTACAAGCACCACGCCGCCGATGTGAATCTTA
CTAGCAATCGCCTCAACCTCCTGTCCACAATGACATGTCAAATTCAGCTTACAATGAAGTGACAAAAAGTGTGCCGACCTGGAATGCTGCACATTTGTCC
ATGGCAATCTCGAAAAAACATTCGACATTATCGTCCTCGAGCCAACTTCCAACGTCCCCCTTGCTCTTGACGAAGGATCCACCACTCTGAGCCAGATTCT
GCACGAATTGCTCTGCTTTGGACATCTCTTCCTGCATGGCAGGCACAACTTCAGCTAGATGCTCCATCGACGGAGTAAACAAGGAAGTCGCTGGCATCTT
GGAGGCTTCGCACATGAACGTCTGCATATCATAAATATTTTACAAAAGTGATAAGAGCTGAGCTCCAAAAGGGTAGACAATGAATGATTGAGCATTTACC
AGAGCACTTTGCTGTCGTCGTAGCATGGGGATGATGACGGGAATGTCTGACAATTCCAGTTTGGGACCTAGATCCACGTGTCCATTGTAGCACCAGTTTC
CAAAACGGAAGAGCACCTCGCGCAAACTTGGTGTGTTCGTAGATCCTTCAGCACGTGGCGTACGTCGGATCAGGAAGGTTTGGTTGTAACCTGTGCCGCT
TACGTCCGTGCACTGCACCTTCAATGGTTTCGGTGGGCTTTGGTGTTTGCCAACATTTGCCGCTTGCCACAGCGTAAGTTTCTTCATGTTGCTACAGTCG
TCGTCACGGTAAGTTTGAAGATGAATTCCTTGTAGGTGGGCAGATAAATCGGGGAAGCGAACATCCAGCAGCGGCTGCTCGCCGTCAGCCGCCTGCAACA
CGACGTAGAAACTGCGGTGGTAGTAAATGACCAGCAGCACAAGACCACGTACAAAGGTCTTGCTAGCTACAATGTCCACTCCGTCAAAGCACTCGTAGTC
CCCACTTTGCAACTCGAAGAAGGTTTTAGAGCCACCGTCATCGTCACTGTCTACCCAAGCATGTTCTTCAGCTGCCTTCATCAGTTTACGTTCAATACGT
TCACTTGAAAGCTCGGCACCAATAAAGTCGTAAACATCGTACAAAGTCTCAAGTGGAGTGAAGTACGGCGACGTCGAGGGAATGGCCTTCCATTCGCAAA
GATATTGCAACGAAGCCTGTTGTTTCTGTAGTGCAGGCACGACCACTGGAAGATCGGCGAGCTCCAGATCGGCACTACCCAAATCGACTTTACCACTGTA
GCACCAATTGCCACAACGGAAGAGAACTTCATGGAGATTGTCCTTGCTGGACCGGACGATGTACGTCTGGTTGTATCCGTCGCGTAGCGCCACAACCTCA
GGGGTGGGGGCTCCGGATTCGTCCGTGTTGATGTCATCTTGGTCAGGTAGGCCCTTCGACGAGGCCCTGTGCGTACTGTTGTCCTCGCCCTTAGCCTCCA
TTGTTGCGACTGCTTTGTCAAGCTTTGCTGCTTCCCTACTGCCTTCGAAACTGCTGAGAATAGAGGGGCGCCGCTGGATCAAACTCAGCTACTTCGGTTG
TGAAACCATCAGCAACGTGGAATCCTAATTGCGGAAGGATGAACATATCAATTGGGATGAAGCCTCGAAACGGATACTAAAACCCAGGCAAAGATTCCCG
TTGTCGATTATATCTACATGGTATCTGCACTGACAGGCGACCGGATGCTGTACTATGTGCACTGGGATCAGTCTTGGATTCATTACCACTTGTGCGGCTT
GGCCCACGCACCGGTGGGTGCTGGGCCTGCGACGGCAGCGACAGCGACAGCAGGGGCGGAAGGAGCAGCCTGCGTAAAAGGTTTAGCCCAAGCATTTCCA
GTCGATCGAGTTGGCTGCGGGGCTGGGGTAGCAACACCTCCAGGCGGTGGACCCCACGCAGCACCAGGAGGAGGCGGTGGAGCCTGGCGACGGACATGTG
GGTTCCGAACGCGCGCGTGAGAGCCACGTAGGATGGCCTGGATCTTGGTCGCGGCCTGAGCCTCAGTCAAAGGTAGCGCTTCGGGGAAGGCCGTTCCGAT
CTTAGTGTCCTTGCCACGTCCGAAACTGAAGCACTTGATGTTGCACAGGTACGGGCCGAGCTGGACGTGGTTGTTCTCCTGGCCATTGAGGTAGCACATA
GTGTACAAGGCCATCTCGAACTCCGGGCTCACTCCGATCAAGCTGTAGGAATCATATCAATCTGGTAAGCTAATTGGAGAAGCATAGTAGTGGTTGTAGT
GACCGATTCGTACCTCGTGGACACAGGCTTCATCTCGTCTTCCCATTGGAACTGGAACGTAATGAGCTGCTCCTTGTTGTGGGGCTCCATGAACTTGCAT
CCACGTTGCTTGGGACGGATGTAGCCTCTGTAGTCGATGCGGCCATGGCGCTCCTCATTGTAAACTTGAAGCCAATTGTGGCAGCCACAGATCTTCCCCT
GCTCATTTTGAACGTGGCAAACCATTAGTGGCCAGAACACCAAATCTTTTCCAAATACCATCACTCACATTCTTCTCCTCGCCCACAAAGACGTGTTCGA
AACCCGATGAGTCATTGCGGACTTCACGGCGGTACAGTCCAAACCAAATGAACTCCAACTTCTTCTTGAAGTCCTGCATATCTCCCGTAAACTTCTTGTT
CTTCACCAACCAACTGAAAGTTGAAAACAAGAGTTAGTCCGTGATAATCCACTAGTTGCTGGAGCGCACCCAAAACGTACGCGTGCGCATAGCGCATGGG
AGCCGTGTCGATCACGGCATTCAGGAAGGCGTTATTCTCTGCCAGCTCCTTGGGAGTCACTCTCTCCGTCACGCCCGTCTGTATATCAACCAATACAAAT
ATTGCTATAACATCAGCAACAAACCTTGCACGTAGTTCAGACAGTATCAGAGTGCGCACCTCACGCTCGTAGTTGTCAAGCAGGTCAAAGAGCAGCTTGT
ATGTGCGGCGTTCAAACACGCATGGGTCTACGAACGTGAAGAGCGGATCACGAGCCGCATCGCCGCGGGCATAGGCGGTCTTGCCTTCCTGTAAGTTCAG
TTCATAGTGCACGTTGGGCTCCAGCCGGTTGGTGTCAAGCTCCCAGAGCTTGTTACACGCGGCCGACAGGCTCTTGAGCTCTGCGACTGTAACATCGTCA
AAGGTTAGTGCGTTAATGTAGAAATTAAAGATGATTTTTGCTGTGTTGTTGCATACAGGTTGGAGTGGCGCTGGCCATGGTGAGTCCCTGGGGGGCTGGT
GGATCGAGGAATGACACTTGCATCCGTCCATCAGGACTTCACACGAGTGCACCCACGCTGTCTTATGCAACAGCTGGTGTGTATCGATGATTTACGGCCA
ATTGTGGCACGATTTTCTGGATTTTTCAGCCAATCGTGCATAGCCTGTCCTGTCACCAATTTTTACTAGCGGAACCGAGCTATGGTACACACTTCTGTAC
AGACCACCGATGGGTTAGTGCGAGATACTTTTCGCCATGGCAATGGATAAGTAGTAATGGAGATCAGTCTAAGGTGTTTCATCTGTGGAAGCCTAACCAT
GTCCTAACCATTAGCGCAGCTAAGCTTAAATACGTAGACGCTTAGACTTACAGTAGATCCATCCGCATCGATGTCTGTTAGTACAACGTTGTTACAACTA
CAAGTTGTATTACGAGGCCGCCAACTGTGCTTAGCACTTCTTCAAGCACCGGCATGGGACTCCGCAGGGCACCGAAAACTATGCTGTAGCAGCGCTGACA
GTTAAGTAACACACTCAGAGTGCATGATGAGGAAGCTGTTAGATTTTAGGATTTATTGTGATCCGTCACTGACAGGTCCCGAAGCCCGAGGCAACGGCAA
CCTGGAAACTGAAGTAGCCGGTTTAACATTGCTGGGTATCCAAGCACCACAGTGTGCAAGAAGGCAATGCAGCTTTGGCGATGGCATCCACAAAATACCG
CCGCAGTGGCAAATCTACTTTACACTCAGCGAATGCAAATTGTAATGCGATGTAAGCCACAATAAAATGCTCGTCGAAGCAGATAACGGAAGTCCGAACC
TTCGTAACGAGGCTTCAACACTCTCCTGTCGTCTGTCCTCCCATACGACATCTTCAGTTTTCACCTTTCCAAGCCAAAGTTCTCCTACACTTCGTCATGG
AACCCCGATCTTTCACGCTTGTCAAACAAGCCAGCAAAAAAAGAGCATGTCGGGTGGTTTTGCTTGGCCAACCGCGATGCTGTGCCTGCCAGCTTGGCAT
ACTCGCATTTGCTACGCTGTAGACAAGCGGTCCCCCTTCTGATCAAGCGTCACGCTCCCCCCAAGTTCCATGTGGGTCCGTCCCGGCGTCCTGAACTCTC
GTAGACTGATCTTTTCGTCCGTCTGCGGTCGCTCGCGCTCGACTTTGGGCACTTTGCGCGTTTTCACGTCTTCCCGCGCGGCGCTACTGGCTGCTGGATC
TCCTTCCGCGCCCGTCAATGAGGCACTTGGCGCCGGACATGGCTTCGCACACGCCGGCCACGGCCACGGCTTGGGACCAATTAGCCTCTCTCCACCCATC
GAAGACCAACAGGCCGTCTACTCCGACTTCATGCCCATCGTACCACCCGAGTGTCTGCGCGTACAGCAGGGTTTGCAAACTGAGGGTCGCACTGTAGGCC
CGTCCTCCTTCACCGCCATGTTCCGGGACATGTCGCCCTACATAAACTTCCATCGAGGCACAACCATGGTCATCCACCTACCTGGACAATTGGTGGAATC
CAACCTCTTCGGCGCCGTCATGCACGACATTGCATTACTCAATACTTTCGGGGTTAAGCTGGTGCTAGTGGCCGGATCGCGACCGCAGCTTAATCGGCAA
TTATCGCTCCGGAAACTCTCGCAGAGATTCGACTGTGGTATGCGCATTACAGGGCCCATGGAGCTCCAATGTGCAATGGACGCAGCAGGATCTGTGCGGT
TCCAGATTGAAAGTTACCTTGGACGAGGAATCGTCAACTCGCCCGGACGTGCCAGAACTATTAACATCGCTTCGGGTAATTTTATCACGGCGCAACCCGT
GGGTGTCAGAGGAGGAGTGGACTTTAAAAACACAGGCGAAATGCGACGACTCAATGTCGATAAGGTGCGCGCTGCATTGGATGACGGAGATATTGTGCTC
ATTTCGAGCATCGGCTACAGTGCCAGTGGTGAGGTCTTCAACTGCCTCTCGGAACAAGTGGCCAGCAAGTGTGCTATTCAACTAGAGAGTGCCAAGCTTA
TCTTTATGCACAACGGCGAGGAACTGATCGACTCGCGATCGAACTCGGTCGTGCAGACTCTGGTGATTGAACAGGCACAACAATATGTGGAGCTGGCACG
ACAAAACCCGGACATTAGCGGTGACTTCTTGCTATACTTGAAGGAATCTATCAAGGCATGTGTCAATGGAGTCAAACGCTCGCATCTAGTCAGCCGACAC
GTGGATGGTGGTTTACTACAGGAGCTATTTACCCGTGACGGTGAAGGTCTCATGATCACTAAGCACATGTACGAAGGGATCCGCATGGCTACAACTAATG
ATATCGTGAGTATCATGCGTCTCATTCAGCCTTTGCTGGACGATGATGTGCTGGTGTCGCGTGACCAGGAACAGATTGAGAGTAACGTGGACACATTCAC
AGTTGTGGAGCGCGACGGTGCTATCATCGCTTGCTGCACCCTTCAGCCGTACGAGAACAACTTTGCTGAGATGGGTTGTGTGGCTGTGGACCCCACCTAC
CGCAATCTTGGCAAGGGTAATGCAATGCTAGGCTACATTATGCGCAAGGCAGCAGCCATGGGCGTCAATAAGCTGTTCGTGTTGACGACGCGAACGGCTC
ATTGGTTCTTGGAGCGCGGCTTCGTGGAGGCTACAGTGAACGACTTGCCCCCTTCGAAGCTGGCCAAGATCGACCTAAAACGCAAATCGAAAGTCTACAT
TTGTGACATCAGCACCAAGAAAGCTCTGGACGAGAAGGAGCTGCTGCTTCAGATGGAATAACGCGGTGAACTTCCAGATTTTACGATTGACCGACTTTTT
GACTATCGGCCAAACACCTCATTGATTAGAACGGAGGCAGAAGAGCAGGACATTGCACTTATTTAAATTCACAGCAAGCTGGACAGCAATGACTCTCGGA
AACCACTGCTCGGATCTTTTTATCCCATGCTTCTCTATCTTGGTTAACTGACGCTATTTGGCGAGCTCGTCTCGTGTTTGGCAGGCATATCCAGTGTACC
CTTGATAACAGGAGCAGACGCCCGTTTTGTAGTTGCACCCCCCACGGTTGGAGCACTCAACAAGGCATTTATTCCCAGCGACGCCTACAGCGGTGCCCCC
TGGTACCGCCTTACCCTGGCAGTTGGTTTCGTCTGCAGTCGTGTCGGGGTCGTTTCCAATGGGGCAGTGACCTATTGAAGTTAAACGTGTTACTACTACT
GCTATGCGTTGGACAAGGATTAAGCGTACGTTTCGAGCAGTCCGCCCCAAAGTATTCTGTGGCTTGTAGCTCGCCGCTTGCCGTCCCGACAGCCCAACCA
GAGTCGCAGACACAGCCGAAAATCCTGTCGGCGTCCCAAGCACCAGAGAACTGCCAGCAAATGATCAAATTACTTGGTGAATCCGATGCTACCGTTTGAA
AACGGGCGTACCGGATTGTCTCCGTAGGTTGTTGGGGGAGAAATGGGCAACGCGTTCTTGGCTGCTGCCATGCTGCGCATACTCATGCACGTTCCTCGGT
CAGAACAGTCGTTCGGACAACTCACTGTCACATACAACCACCAGTGAGCACAATTTAACACACAATTCTCCACACCAAGATGCGTACTCCTTTCGCATGC
AGAGCCTTCAAAACCGGGGAAGCATTTGCAAGCCCCTGCAGCTCGATCGCAGACCCCCATGCCGGAGCATTCGACAAGAATGTCATGAGCTGTAGTGGTG
CTTGTGGGAATAGAATTCCAGGCGAAATTTGATGGACATACACCTGCAATGGACGATGAGTTAGACTATCTGCTACATGGTTAATCAGTAGGATACTCAC
GAGTAGAACAGTCTGGTGACTTGTATTCTGCTACATCCGTTGGTGATCCCCAGCCAATGCTGCAAATACAAACCTTTGAGAGAAGCGTACACGTACCATG
ACCACTGCAATCATTCACATAGGTACACCCTTCGCCACCTACAGTGCTGCTCTCTTCAATCGTATTGCCTCCTGCGTCTCGAGTGCGTACAATAAAGTTT
CCAACCGCATTATTTGAAGACGTGGTAATCTTGTCGACTGTGAACGAGATTCCGCTTGTCGCTGGGATATTCGCGCCTGCAATCTGTAGTTTAACGGAGC
TTGGTGTAGAGATAACAGCGCTACTAGCGCCGGGAATATTTACCAAAGAACTCGCTGTAATCGTCCCAGCCCCAACACTGTAGTCAGCAGGAAGTACAGC
CTCGATATAACCTCCAAGAGGAATTGTTGTCGAGGTGTCGAGCGTCACAGTCGCTACTGTAAGTGTGTTGGGAGTCTTGAGCAACGGGCGAACACGACCA
TACGTGAGCGGCTTCTTGACAATCGGTGTACCTGCCACTGTCGTCAACGCTTCCAAGGCATTGCCACCATTATCGGTGATGGTTACTGTGTACGATCCCC
ATGTGGGAGTGCAATACTCGACAATGAATTCGTCGCAGGAGGAGCCAGGATTTACGATGTTTTGCAGCCTAAATCCACGTCCGGTTCCAGGTAATACAGC
AATATTTCCCAGCGTCACTCTTGCAATAGTTGAACTGGCCAGAGAGACAATAGTATTCACGATAGGCAAGTTTGTGATGTGACTCAGGGTAGCGCTGCTA
ATGTCAAAACGGGACGGAAATGTTACCTCCACTCGACTTCCTGGTGGCACGTAAGCCAAGTTGGCAAACACCACGTTGTATTCGGTCGTAACACCAGCCC
AATAGGATACAGGAGTTATCGTCGCTGACGGAAGCGTTGTGCTTGTGAATGTTAGTGTGTTCGTAGCAGTACTGACTTGAAAAATGGCACCATTGGGATG
CCGCGTATCAACGTAGAACGGTGGTGTGGACAGTGCTGCAGCATTAATGATGTTGCCGTAGGTGATCGACACAGTTTGTCCTGCAGCGATGTCTTGACCA
GCAATTGTGAGGAGAATATACGGTGATGACACTCGCAGCTCCGTTGACGCTAGATCGATGCCCACCAAGCCTGCAAGAGTAGCGCTGCTGAACACGATCG
CGCCGCCGCTGAGAACAGGTACTTTCAGCGCAATGACACTTCCAATGCGTAACGTGACATCGGTTGTCAAGGTGGCCGTGTAGGACGTTGTTCTACCAGC
AAGCAATGAAGGAGCTGTCACCGTAGCAGCATTGGACATAGTCCAAGAAGTGAAAGTAGAGCCTGGTACCGTTACTGACTCCAAGGTTGTGCCACCAGCA
TTCTTAGTGCGGATGAAGTAGCTTGATGACAAGCCCAAACCTGCGAGCTATCATGTCAGCCTTCCCAGCATTTCATTCCGACAGGACGCAGCGTACCTGG
ATTCGAAATGCTATCAAGAGTAAAGGAGATGGCTCCAGCTGCAGCATTGGTCGTTGCAATCGTGATAGTCACTACGCCAGTAGCGGGTGATGCTACTATC
GTACTAGTTGAATCTATGCCAACAATGTTGGACAACGTCGACGCCGAGTCCACGTAGAAAGCAGAGGGGAATGTCAAGACGATCGTCCCGCCGACCGGGA
TGGTGGTTCCTGTCGTGAAGGCCACATCCACCGCTCCCGTGACGCCACCATTCAGAGATACCGGAATCACAGACGCCGAAGTGATCGCCGCATCACTAAC
CTGCACGCATAACGCCCAAAGCAGCAGTGAGATCAGCATTGTGTCAATGGCAGCGTTTCCTTTCGCAGCTGTTCATGACTTCCAGATGGATACAGTAGAG
TTCTAGTTTGAACTGGAAATCATAAAATATTCTAGAACACCATTGACATTCATAAACCAATATGTGGCGTCGAGCGCTTGTGCGTTGCGCGCCAACGCTG
CGATCGTCGTGCGCTGCGCCCCAGTCGCTCTCGTCTCAGGCGCTGCGCCGGGTATGCACAGCCAGCTCCTCCGCGTCTCATCTGCTGCACGTTTCCAGAG
CCTCGTTTCCGCACTTGCACAGCCATAGTCGCTGCTTCGCCACTCAGAGCGGCGATATTGAACCACCAGTTTCGCCGACGACTTCCAGCGAGTCTACAGT
CTCGGCCACCGAGTACTCTGGTGCACCTGGAGTAGAAAGCCCTGGTGAGAAGTTCGTGATGGTCTACACGTGCAGCGTATGCGAGACGCGCTCAGCCAAG
ACCATCAGCAAGCACGCCTACTACAATGGAGTGGTGCTGGTGCGTTGCCCTGGCTGCGAGAATCTGCATCTCGTCGCCGACCGGTTGGGCTGGTTTGAAG
ACGACTCGACGGACGTGGAGAGTCTGCTGAAGCAGAAGGGCGAGAGCGTCCGCTTCGTCACGGGTGAGAACGTTCTTGAACTCACAGAGAACGACATCCT
TGGCAGCAAGAGCGAGGAATAGACGCCAAGTACAATAACAGTGAGGATTCTTTTGCAAAATAGACATTCTGTTCTTGCAGAGAACGCGTTGGATACATGC
CTTTTCAATTGATGTGTTCAACCGCCTAAAGTAAACGCTGCGAGATATTTTCTAGCTTCTGCTCGGCTCAATCTACGCGGATTGACGCTGGAATGAGCTG
GATTAGACTGATTATTCCTCGGTGAGATGCTGAAGCCACACCCTCCGGCCTTCGCCGCGAAACATGACCTGCTCGTGCGTGTTCACCTGTACGGAAGGGT
TCGCAGATGCCAGCTTGGTGGTCTTAGCTAGACGCGTCGAGTCGATCGTGCTGGTCTCTATGTGGTGCTTGCGCTTTTTGCTCTGGTTCTTGTGTCGAAC
CATGTGCTCTGACAAGCTCTCCTCCTTCCCGTACACACGTGAGCACACGGGGCATTTGAACCACTTCTTGCCGTTCTTCATCTCGATGATAGGTTGGAGT
TGATCAGGCAACACAACGGGCGCCAAGTTGGTTTCACTCGACGTCTTCTCTTTGTCCTCTTCGGGTTTACCCGCACATTTGTGGAACTGCATACCGCGAC
GTGCGTTAAACTTCATATCACAGAGCGGACACGTAAACGGATGCAGCTTCTTCTCATCCACAGCTTTGTTCGGTAGCAGCGCTAGACTGGCGATACCTGC
CTGCTTGTTTTGGCCGATACGAATACCATTCTGTGCCGAGTACATCTCCTTGCTTGTCTCCATGTACGCTGCGATCACACAGCCAGCCACCATAGCGTCG
AATTGATGCACATGCTCACGGACGTCACGGAATTCAGCAAACATTTTCTTAGCGCGACTTCCAACAATTTCGTGTAGATCCAAATTGCTGATTGTGTGGT
CAATCAAGCGGCACGCTTTTTGTTTCATCTACAGGCCACGCCATCCACGTGAGTAGGCTTTAAAGGCAGAACAATGAAATGCTGCCAACCGTACCTGGTC
CTTGTAACCAATACGCGTTCTTCGCTCATCCTTGCCCATCTGACTAAGGTTCATCTCGACGAACTCGGCTGCGCGTCTCAAGTTCCCAGCCATCTCTCCA
TCCTAGATCAAACCAGCACTCGTGAAATAAACGCTTCCCTCCCTTCGGCACCACCACTCTCAATTACCTGCGAAATCAGTGTCCGTAGGTTGTGACCAGT
CGAGAACAACTTGTTGGGCGCAGGTCCGTGGTGCGACTTGTCCTCTTCGCCTTCGAACTTACGGTAAGCGCTTCCTTCGTGCACAATGTGGTCCTGCACC
ACTGTACCGCATCCATTACCATCCACGCCATTACAGATCGTATCTCCACGTGCGTAGTCTGTGATGAAATTGTTCTGCTCTGTGTTGCCGCAAGTCTCGC
ATCGAAATCGCGGTGCTGTCAACATTTCAAACAGGATTAAAACACAAAAGTCACTACCTCTTTTACAGCACCGAACAACTCCACCAGCGCGTATATTAGC
CCGGAATTTACCTGTCTTCTGCTCAGCATCGAGCTCCGAGAACTCGTCAGCGTCGGACTTGCCGGCCTGCTTCATCTTGCGGATCAGCAACATCACGTCG
TTCACCTTAAGTTCGGGCACCAGCAAATTTACGATACGCTCCTCCATGGGCAGCGCTGGTTCATCGGCTTGTCTGGCAGCTCTAGCAGCTGCAGCACGAG
CTGCCGCCTCCTTTTTGGCTTTCTTGGCCGCCTCCGCCTTCTTTTTCCTGTCGATCTACAGCCAGCATCAAACTCCATTAAAACACGAGTCTCCACAGCA
AATAATACGCAAAACTAATTGCTACAGACCATGACGAGAGGCTCATCATCCAGCGACGGCCGGCCACCAGCCTCCGCGGTCGCGTTTGCCTCGGCTTCAA
CGGCTCCGAAGCCCGCGAACACATCTTCAGCTGCGCCGTTGTTCAGAGCCGCGAAGAAGTCGTCAGCACCGGCATCGAGGTCCATTGTGGCCAAAGGTTG
GTACGGTAGGGTACGTAGGGTGGAACCCCGTGTCTCTGTGGTGCCAGGGGGGCAGGTAGAGCGAGGGAGGGTGAGCACTTCTCCCCCACTTGTTCAAATG
GCGAGTGAATGAATACTCAAGAGGCAGAAATATGGAAGTATCGTAAATGACCAATTTATGGCATTGGTTGTTTGTTTGGGGTGTGATGGATTGCTATTTA
AGGTTTCCAAGATGGAGCCATGCCTGTTTCCGATAACTAGCGCGACAAACTGGGCATAGCGAGACTTCGTAGATGTTGAAGTCCTCGAATGCAGAGAGGC
ATTGCGAGTGAAAAGCATGAGAGCAACTGAGGAGAGATACACCCTCCATTGACGAGCTGTGTGGCAGTTTTCATGAGACACTGATTCGTTGATAGGAAAT
TGATAAACAAAAACTTCGTACCTGAACGCGTTAATGCAGATAGCACATTCGCGTTCGCCTCGAGCTTTGGCCTAAACGAATGGTCAGCAACGTTAGCAGT
GTTGATGATTACGGCGAAATGGAGTTTTTCGACATAGCTGTAACCTTTTTGAAGATGGCAAACCAGTCGTCGCCTCCAGGGAACGAAGATCCTGTCGCCG
AGGTATGCAGAAGTTAATGATGTGGCAAAACAAGTCCAAAACTACAGTAGAAGTCGTCACCAGTACCGGTCTCAGGGACGTGGTCTTGGAACACACGGCG
GCTCATATTCAACGACTTGTCGAACTCAACAAGTAGAGCATCTATCGAGTCATCGCGCATGCTCATTGCGGTCACCAATCGATCGGTTGTTTTTCCTACC
CTACAAGTAGGCAAATGATGAAGCAGTTGAGCCTGATGAAGTGAGGTTCAAAACGTGTTCATTATGGTACCTGTTGGCGAAAAATCGACGACGACGAGCG
GGGTCACCGTTGCCGGAGCTATAGAACTACATGTACAGATGAACACAGCGCGTAAAAACTAACCCCAGCATCGGGGTGGTCGGGTAGCAATGATATAACC
TACCTTCTGCCACAAGGTTGTTGTTTGTCGTCTCGTTGCAAACCCCCGAAATACGGCCTACATGCAAACCAAGTATTACACTAGATAAACTTTACCATCA
TCAGATTTCTTCGAACCTGAATTCGCTTGGCACTGCATTCGCGATGAAAAGCTGATGCCACAGTGGTGCACCGCTTTTGGTAGTCCTGCTTCCGGCAAAG
TGGGCAAACGTGCTGATTCGTGCGCAAAAATCTGGATTGATAAGTTATTAGTATGCGTCGTACGAACAAGATATGGTGATGAACTTGCCTTTCAAAACTT
GTGATGCAATCGAGATGGAACATGTGCGAGCAGCTTAAAATCACTTGTTCTTTTACTCCGAACGGTTCACGGCAGATAGAGCACGGGTGTTTGGTGTCGC
CACGTTCTTGTGCTTGCTGTTCGCAATGCTCCCATTCATCTCGTGTGAGCTTCGGTGGTGGCCGAGTAACCTGAATTACAACAGCACAGTGAAGAATACT
GGATGGTCACATTGATCGTCTCGAACGTACAAGGCCTCGCTTCTGCGCAAGAGTTAATCTAGGGCGACGTTGTTGGCTACGTTGCGTTCCACAAGAAGAG
CATCGATCCGAATCTCGGCCGCAATTACTTGAGCGCGGCCTCTCATTATTTTCGAAAGTGCAGGTCTCGCAAACCCAGACACATCGATATACAGACTTTG
ACATGTTCCGAATTGTCAAATCGTCATTGTTCTCAATCTGCTAGTGAGCCACTCATGTGAGCGATATGTCCTTCAGAGTTTCTAGTATATGAATGCAAAA
ACAGGATGCCTACAGTTGGTTTTCGAGGTCTTCTTGAACGAATATGCAAGTCGAGTGTAATGGATCGTGCTAGGTGATCCTGAGATCATCCAAGCGTCAG
TAGAAGCATCAGGATAAATAAATATGGTGGGTCTACCTGTAGCGCGGCTGCATTGATGACCGTGGACTTGTCCAGTTTGGAATATGGAAGTGTAGCTGCA
ATAAGGCCACAATAAACCAAATCAATTCACTGAGTTCTCCCGGTAGAACTTGATATCCATCCACCTTCGGTACGTCTTCCACGCCTCATGGTTTCGTTGA
CAACAGCGATCAAGAGCAGTTATCGAAGCTGCCCTTAGTGTTGAGGACAAGCCACGTTCCGTTTCGCTGAAGTCATTGCGCCAAGGGTCGGTCGAGATTC
TGTCCATTCCAGATAACGGCTACTGTCATCCTCGTGCCGTTCGTTCATCTATCATCGCGAATGGAGCCGAAGCGTTTTGACATCGACGAGGAAGAACTCG
GTTGCAAGATCCGCAACGTGAAGCTGAGCGAAAAGTGCCGCTTGAAGGATGAAGAGAAACCCGTCAAGGATGATGAGTCCCGTGCCGCCCAAGCCAAATT
GGATTTCGAGGTCGAGCGGGAATGGAAGCAACTTCAAGATGCTGGAGTTGGCAAGATTGAGATTTCCAACAGTTCCTGGGCAAAGAAGGTCTGCAAGGGC
CTTACCATGTAAGGGAACAAGTAGAGTCCATAGAATGTCACGGCAATGATCACTGATGCGTTTATTCTGCTGGTAGTAACCACATGAACATGCGTTGTGC
CGACACGGGTCGGCTGATGTGGCAGTCAGATGAATGGTACGTTCAATCAACTAAATTGGTGTCCGTATGATCCGCTGGTTATTGACTTTATCTAAATGTT
GATGCCAGGGGCCAGGATATCTTCCGCGTCGAACAAAAAGGTAGCACAACCGATATTTGCTGAAGTCATCCAGGTGCTAATCGTGCATTTTGTAAGTTAG
CTCGTCTTCCGGTGGAGATTTTGAAGTGCCCTGCTGTGTCTCGCGAGATCAACTTCAGCTCAGCTGAAGAGATTACCAAGTTTCGACTGGAACAGCGTGT
CTTCTTAGCAGGAAGCTGCATTGAAGGTACGTCTCTGTTCACGCTTGAGAATGAATGGACTACACTGAATGACTTTGTGCATCTATTCTTCGAAAGAATG
GATTTTCAACTTCGGTTATGTGATCCCGGGCTCAACTAATACGTGGCAACAAACCATTGAATCAGCCGGCCCGGAAAATATGCTTGATCCGGAGGTGATG
AGGTACGATTCATTGCCTCTTGTTTAACTTTAATGCCTTCATCTCACGGATAGTTCATGTTCCAGCGGCAAGCTCACGATTGAAACGGCATTCTACGACG
GCCAACTGCCGATTGCCAAGACTGTCTACAGAATATATTACGTCTGATCGCGCTGGCGCCAACCAAGACAATGCGCGCACAGTGAAGCACCACAACGCCC
CCAGATGAGCAAATAGCTAAAGGCAAATGCATGTACCGCAGACAACACCGTTCTTTCATGTCGAAACTACTGCCGCTCTATAGTTCTAGGCGCTTGTCCA
CTTCTCGTGTTTCACCTGCATTGATCGCGTCGATGGGATCAGGATAGGTAGGCAACTCAGACTTGAATAGGTACAAGTCGCGGATCCGAATAGGTCGAGG
AAGTGCTCGCAGCTCTGCAAGTTCCGCTTTTGTGGCGTTCTTGCGTTGTTCGTGCGCTATTTTCTCGGCCGGATTGCCACGGCCGATCACCTGAACAATC
AACTTCTTGGGGCTTTGTAGAATCCACTCGCGGTAGTGCTGAGCCATCTCACTCTTGGTCAGCGTCTCCATCTCCTTGGCCAGCTGAGCGTCCATATCGA
ACGCAAGTCGACGCGACGTGATCTCATACCAGTAGTGGTGCGTCGTCTCTAGAAGGTTGTGATCAGGCTCGAGTTTCAACAAAATCTGCGCTTGAATGTG
ATCATGGAAGTGCTCGTCCGCCATCATCTCGATCGCCTCTTCAAAGTCAACCATGAAGCGGTCAACACACGCAGTAATATACTCCGCTGCGAACAATGAT
GACTGAACCATCACGCCAAAGCCCAAGATGCCGTTCGTCACACGAACAGTGCAAGAAACGTCGTAACCCAGCTCCTGCTTAGTGCGCAGAGTATCAAACA
GCGGTTCCTCCATCAACTGGTGCAGCAAGTCAGCGTAAGCCAGGCTACGCAGAGTCAACGGGCCGATCTGGTAATAGAGTTCCACTTGAGTGTTCGTCTC
GGTCTTGTTCTCGCTGCGCTCCTTAAGTAGAAAACCCAAGGGTGTCTGGGGGATGGCATTGATAAGACGACGCGGAAAGTCACGCAACTGGAGCGGTGCA
GACACACTTTGCAGCTGCGATTCGACATTGGCGATCATCTTCGACGCTACTGCATGAGAGATATTTCCATGTGCAAAACTCGCCAACCACGCCTTGCCCG
CCCAGAGTTCGTTCGAGACGTACTTCTTCAGCGACTCCACGGTAGCAACCTCGATCGAGTCCAAACATTCCTCCAAAGAAAATGAGCGAATTTCCAGAAG
TTGCAATCGAAGATATTTCGCTTTTTGTGCCACCTTCGTGATCGCGTTCTTCGATTCGCGCATCAATTCCTCTCGCATCACTTCAAAGCGTGCTTCATTG
ATCTCCGTCCCAAACACAGCCGCAACGACTACCTCGACAAGGATGTGGAGCTTATCGTTGAAGCCGCCAAAGATCAACTCCAGACCAGACTCCTTTACCT
GAAGTGAGTACATGAGCTCAGCCACGTTGGCGTGGTAGGCGTACTCGTTAAGTGCATCCCGAACGAGCTTCACGTACAGCTGAGTATGACTCCAGTTGTC
CACATTGGCCACCACACTGGGCAAATGTATCAACATCGCGACATGAGCACGAGGTGTAGCAAACACGCGATCCGGCTTGTACCACAACTTGCCGAACTTC
GTCGTATCACACACAAGGCCCTCAACATCTGTCGAGTCCACAAGCGAGAAATCCCGAGGGATAAATTGGTTTGGACGAGGCAAGTGCAGCTTGGGGTTAC
TCCCTGCACTCTTCCAGCGTTGAATAATGGCTTCCGTAATATTCTCTTTCGAGTACCTGACGTCAAACCATTCCTCCTTAATAGCCTATCACAATAAAAA
AAGTCAATACTCAATGGTCAAAGCTACAGATAACCCTGCTTCGTGATATACCTGCTTCTGAAATTCAACAGAGTCTTCAAACGTTTGGGAAACGATCGAG
ACACAGACGGACTCGGCAGTCAGGTGACTCAGCACTTCTTCTGCTAGCTCCTTCTTGAAGACCCCCTTGAAAAGGTCGTACCGCAAGATGTCCTCTGGCG
CCACTCCGAACATCGACTGTACCCATGCAAGTAGTTGATTCAAAATTGCACAAAGGTATCACTATGATACGATAATGCTTACCTGCATAATCTCACCCAA
CTCTTCGCATCGTTCGACTGCACTATCCTCTTCCTGAAAGCGGAACGAAATGTCCGCCAGTGCCGCTAGCTCGTCAAATACCCACTCGGGGCAGCCATGT
ACCCTGAGCATATGAAGATACTCAAATACTGCATGGACGATTTCTTCCCAGTGAGAAATGCCCTCTAGTGTGAGCTTCATCGTGATATCAAACTTTGCTG
CGTAGCTACCGCTGTCGTAGCCGTCTGTGTCTGTTACTCCGGCGGTGACAGCTGAGATCCAGCCTCGCTCTTTCAGCTGCAGTGCACACGGCATGAAGCG
TAAGTATAACTTAAACAAAACAACTAATTAGGTTGGCTAGCTTACATGTGACAGCACAGATCCCTCGCTTTCGTGGCCCAGGAGACTAGCAATATAGTCC
GATGGCTTCTGGTGATGTTGACCAAGAACCGGAGGGATCATCCAGTCAAGATGAAGGGTGTGGATATCCCGGACAGGCACGATCTTGCAGAGGAATGGAG
CACCAGCACCTCGAGCCCCAAACGGGGGCCCTGCTGAAGCAAAAGATGGCACTTCCACGTGTTTGTTCGGAATGGCGCTGAACGACTTGGCCACCCACTG
CTCTAGCTCATCCAGCGTGTTTTCACCACATACAACAAGCTTCATGATGCTGGCCGAATAGTATTTGTTGTAGAACTCTAGAATCTGCTGTCGCACGTCC
ACATTCATCTTCTTCGGTATCTCCTGGAGACTCTTCTTGTTTCCCCAGCCGAACCGATGGTACGGGTGCGTGGCAGACGATATGTCGCACAGAACTTGTT
GCGTACGGATACGGTCGTTCTGTGTGGCCTGGCTAAACTCGGACTCGATGGCTGACAGCTCCCTGTCCATGGCTTCGGCCTTCATTAGAGGAGAGATGAA
GAAATGCGCGAACATGTCGAGCGCAGGCTCCAAATGGTCCGGCCCCACCTCGAATGTGTAGCTAGTCACCTCGTTGTCCGTAGCCCCGTTGCTATAGCCA
CCATGAGCGCTTAAAAAGGACTCAAACTCGTTCTCATCCGGGTACTTTTCGCTGCCCATGAACAGCATGTGCTCTAAGTAATGTGCCAGACCAGGAAGCG
ACTCGGGTTCAGCAAAGCTGCCGACGCCTACAGTGAGACAGGCTCCAGCGCGACGGATAGGTGCACCCTCATGTTCTTCTTCATTGTCATCGAAGTTGCT
TCCATCGCCTTCTTCGCTCTCGCTGAAATCGCTGCCCTCATCGCTGTCGCTCTGATTGCCATCCTCTCGGTTCGCACACTCGCTCTCGCGCGCCACAGCT
GCCGCTACGTGCGCCACCTCCGCCGTGGAGATGAGGAGCGCCTGTAGCGCGTTGGGAAGCGTCAGCAACCGGTACTTCTTCTGGTCATTAGGCGACTTGG
ACTGCTCCACCGGGTCCGTCATTGGCGCCGTAGCCTACGATTGGGAACTAATGAGCAACATGACGATCAATTGATTCCCATAATTATGGTCCGATTTTGA
AGCCATGTCTGCAGCTTATTTAAATCAAGTGATAAATTTGTCTTCTTTGATGAAAAGAGTACGTTTTCATTTTGGGACTTATTTTGTGGAGTCTCGCCAG
CCACAGACGACAAATTGACACCATGAAGCTCGGCCGAGGCATCAACGTGGAGCACATCAAGCGTATGACGCTGCGTACCGTGCGCGAGAGCACGGAGGGA
CAACCAGAGACGCTTGCGTTCTTGGACGCTCTGGAACGCAACGACTTCGACGAGACGAAATGCAAACGCGAGGCACGCCACATGATGCTCGTGCTGGAGG
CCAAGAGGAAGCGTCGCGCCGCTGAGCACCGCTCCACGCTTAACTTCCACGTGATCCGTATGATGAAGGGGCACCACGACCCGCGCCGCTAAGCGAGACA
ACGGACAGGCAAGAGACTATAGGGAGAGCAGAGGAGACGCCGACGGCAGAACCCTATCATTTAACCGATAAACTCTCGCTGGTGTCGCGTTTGCGATACC
AAGCGCCGTTTTGCATGTGTTATTGACGTCGTGTTGCTT