Description :
From Genome Similarity Track
Location :
Scaffold_67:280403- 283143
Transcript NameFunction/comments
Phyin_T30-4PITG_18322Putative uncharacterized protein

Sequence
2740 bases(100 bases per row)
AGTGCCTCGAAGCGGGCAAAGCTCCAAAGAAACCCCCGACCAAAAGATTCATTGACTTAAACACAGTATACGGACTTAAACACGAACAAGACGACCCCCC
AACATGGAGGCAAATGAGACTGAACGCAGCCATCAGAACGACGGCCCTCGTGGTGATGGAGGTGTGGCGGGCGCTACCGAAGGCATCGGCGAACACCTGG
ACCTTAATCAAGGTGGTGTAGGGCCGACCAATGTCCAAACGGAAGCAGAGCCCGCTCGGGGATCGCGCGCGTGGATCGAAAGCATGGAGAAAAAAACAGA
ACGTACCCGTTGGCATCAAAAGGACCAAGCTGTCGGCTTAAAGCGCTTGAGAACCAGTTCGACATCAGCAGACCACCGGACACCACTAGCCCGACCGGAA
ACAGAAGAGCGCGAAGTCGAGACGGAGCTTCTAGAGGATCTCGCAGATAATGAGTGGGCAGACATTGAGCGAGGGCTCGCGCAATCTAACATGCAAGTGT
GCTTTTTAATGAATCCGTTATCGGTGGTGGTATCTAACGGTTGCGAGTGGAAGCTGGCTGACTTCATGACAGAAAACTTGGAGTTCTGTCAGCAGAATGG
CATCCGCTTCGAAGGCAATGACCTCTTTCTCGAGCTAAAGGACCAGGCGTATCTCAAAGGAGTTCCTGTGCGGCAAGACCGGTCACTGTGGCAACTGATG
AAGAGGGGATATATCCCCATCACGACCAGTGATACAGTGACATTGGTATGGGTACAACCCGCGTACACGGGCATGTTGGCCACGAACTTGTCTCTGTATG
AGCTAGAGTACCGCAACGGAAATTACGTATCTCCAACTCAGCTACGTCAAATCGTTAAAGCAGTGGGGAGCCACGGATTGTTTGGTTGTGTCGCACTCCA
TGTACATGAACGAGAAGCAAAGATGGTCTCCGGCGGCATGCATGCGATACGCTGCAAGGACATCGCCGCTGCTGTACTCATTCGTTTGTTCTTTCCAAGT
CCAGGTGAAGCCAACTCAGGGTACGCTAACTACCTTCAGGCGGCAAAACACCGCACGCGCAGAAGGGGGATCCTGCAGACACTATTACCCTCAGCCTGGT
GCGTAACACAGACTGGGACCCAGCACAAAAAGTCTTAATTCGTTTGACAAAAGCCGTTCGTGAGGCACAATACTCGAAAGGTGTCATCGTTTATGGCGTT
ACGAGTGAGGTGAAAACGTTATTTCTCAAGGAGGCTTTTCAACGTGCTGAATACACGCCGGAATCTGCCAAAGTACGAAGAGGCCTAAGCAAGTCTGCGG
TGGTAATGTTTAGCTCAGCCGATGAAGTCCACGAGGTACTCCGCCAGTTCGGGCCAGAAGCTGTAGAACGATTAGCAGTCGGTGACATACCACTACGGAT
TCGAGCAAGAAGTGGGAATGGCTGCTGAGAATGCCATCAAACCGGTCCTGTCCGCCGCAATTGCCCCCAACTAACATCAACGCAGCAACACCGAGACGCA
CGTGGATCAAACGCACACCAGACTCCAAGCACTAGTCAGCTTACGGTACCTCACAACATGAACAACGCTGAGCGGCTTGTGGAAGCGTGCCATTGAAGCC
AAGATGGCCACTGTACACACATCACTAGCAAACATGACGCGTTATTGCAAGGCAGCCGAACAACGTTGTCAGACTCTCGAAAACCGATTGGATGGGATGG
ATGAGATCTGGAACGCAAGGATGGTGCAAATTGTCGAGTTCGCTCTAGCGAAGCAGACTGCTGCCGCAACACTCCAGGGTCAGCAGCGCAGTGGAGATCA
AGACGACGCAATGGGCGAATCACGGAACGAGCCAAACATTGGCCATGCACCGAGTCGGTATTTTGCGTAATGAGGCCACATACGCCAGGTGTGGTCTCCA
GAACAAGCAAAATGGGCTTTAAGTGGCAACTTCTGTGGATGATAGCACTGTTTCTGACACTGACATGTCAGGTAACAAGGGCAGCTGTGGTTAACGATGA
CAACCTTCAGACCCAATCAGGAGCGACGCTGGTAAGGCCCGAGGCCTACAGCGAGACTAACCTGGATATGAACTCCCTGAGTGGATCCGACGAATCCGTG
CTAGAGGGTTAAAGATGTGCAGCTATGGATACCACTACACGGAGAGCGGAGCGAGGGGGTCGATACCATCGCCGGTGGCGACCAACTCGGTGTGTTATTT
TAAGCTCACGTGCACCTGTCCGAAGCACGATCCTTCAGTCCATTCTTCAGCGGGAGCACTACTCGGGGGACTACATCGGCGATGACGTTCCATCACCGAT
CGACGCGGAGCACGATATTCGGATTTGTACGGTGAACATTAATAAACCTTACGGCATAAAATGGAGGAGGAGTTAGCTGGATGGATACTGGCGAATGGCA
TTGACATAGCAATTGTAAGTGATACCGGACTCCGCCCGCAACGCTCTCAGCAAATCTGGGTAGCGACTGCCGATACCAACGACCAATACCAGGCCTTCTT
CTAATCGGCACCAAACGGATTGCTATGGTGTTCAACAAGGAGCGATGGGAAAACAGAGTGATCAAACATAGCGTATGTTACTCGCCCACACAAGGAGATC
TATGTGCGTTGCCGTACGCCTAGCCAAAGCGCGAGAGTTATGGATGATTGGCACGTACATTCACCACTCCCCAGAACGGCATCTCGATGAAGTACACGAT
GAGTGGGCATGGGAACACGAGCGGGTGGTAGAGGGCCGGG