Description :
From Genome Similarity Track
Location :
Scaffold_37:2804- 4570
Transcript NameFunction/comments
g9212.t1hypothetical protein

Sequence
1766 bases(100 bases per row)
GATGTACTCCCGGACGACATTCCGGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGGTTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGAC
AGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGC
GCCTACGTTCCGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACAATGCGACAGTACCGGCGCAGACGCCGATACCT
CGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATA
TCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGT
CACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGATGACGTGTTCATTCACAGCCCGGCTGTGAATGAGAGATCGGATGTGGAGATG
CATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCAGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTAC
TTGGGTGTCTCGTTGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCATACGTAAAGGAACTGCGGCA
GTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAAATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAA
TGGACTGATGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTG
TGTGTGATGCATCCGATTTCGCAATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCC
AGCTGAGCGCAATTACCCGGTACATGACAAGGAACGCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTG
GTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAGTACAACTTCC
AGGTTGAGTACAAACCTGGAAGGTTGAATGCCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGCGCAAGAGCCCGACCACACCCTCTTCGTCCT
TGCTGGATGACGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGC
CAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTTGACGACAACGCAGATCGCATTGTCGTGCCGGAT
GATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGATATACTTGCTTCTCACGCGTGACT
TCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTCCGTGCTTGCGAGGTATGCCAGCGTG