Description :
From Genome Similarity Track
Location :
Scaffold_237:28039- 30500
Sequence
2461 bases(100 bases per row)
TTCCGTCATAGTTAACCACTCCGAGAAGGCACTGGTCCATAACAGTGACAGGAGTTCTTTATCCCAGATCTTCGCAGCAGCTCGTTGATTAGGGGCAGTC
GGATGCCACCCATCAATCCGAGTCAGACCCATTAACCAGCCGGGTAATCAAGGCACAGACGTATATCCCACGCCGTTTTTCTTGATGATGATTAACACTG
GGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCG
CACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCCTTTCCTTTACCAATCAGCAGATGT
CGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCA
GTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGG
ATCCACCATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTATCTTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGA
TCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTG
GATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCGGGGGATC
GTCCCCCGTCCTGGATCCAACTTCCATTGCTTGGATCTCAACCCATCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAG
GGACCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATC
CCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCACTAATAATCTCTTGTCGCTGACGTT
CGTGACCTGGAGGTATTGCGATCGACCTGGTCATTGGATTACGGTAGGTACCTATTTTTCGCCCCGTGTGACCCACAGTTTCTCATGTTCCACCCACTTT
AACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCCAATTCGCTCCATACAACGGCCTCCGTCCGC
TGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGCACCATGAAATCCATCCCAAGGATGGCGTC
TTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATGCACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCT
TCACCAATCCCACCACAATCTTGGATCCGACTCCCATCCACTTGACACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACGCCTCGGCACCACTAT
CTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTC
TCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAAGC
TCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTAGCAAATTCATCCA
CTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTT
GTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCATCCTAGATTAACATCTTCTCGACCACTTCCGGCA
ACATCCTCTGCGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGA
CATACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCTTAATCCGACGATCCCTCTGTAGGATATTTCGCG
GAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCCCCTC