Description :
From Genome Similarity Track
Location :
Scaffold_30:28037- 31156
Transcript NameFunction/comments
Hyaar_Emoy2804584T-complex protein 1 subunit alpha
Hyaar_Emoy2804585LOC100283716 putative

Sequence
3119 bases(100 bases per row)
CTGTGAGTTCCATCAATGTGCTGAAATCTCATGGAAAGAGCGCGCTGGAGACACAGTTGGTGGACGGCTTTGCTCTCAATTGCACCAAAGCGTCGCAGCA
GATGCCGACGTACATTAAGAATGCCAAGATTGCGCTGCTGGACTTTGACTTGCAGCGTCATCGGATGCAGATGGGGGTGCAAGTGATCGTGAACGACCCG
AATGAGCTGGAGAAAATCCGTCAACGCGAGGTGGACATTACCAAGGAGAAGATTTACAAAATGATCGACGCTGGTGCCAACGTGATTCTGACCACGAAAG
GCATTGATGATCTGTGCCTCAAGTACTTTGTCGAGTCAGGTTGCATGGGTGTGCGTCGCTGCAAGAAAGAAGACTTGCAGCGTATTGCTAAGGCTACTGG
TGGACAGGTTGTTCTCACGCTTGCCGACATGGAGGGCGAGGAAACGTTCGACCCCTTGACGCTCGGCGAGGCGCAAGAAGTTTGCGAGGAGCGCGTCGGT
GATGGTGAGTTGATCTACTTCAAGGGCTGCAAAACGCGTCAGGCTACGACGGTGGTGTTGCGTGGTGCCAACGAGAACATGCTTGACGAGATGGATCGCT
CAATGCACGATGCGTTTATGGTAGTGAAGCGTATGCTCGAGAGCAATCAGCTTGTTGCTGGTGGTGGCGCTGTTGAAGCAGCGCTATCGATCTACCTCGA
AAACTTTGCCACGACGCTGGGATCGCGAGAGCAGCTGGCCATTGCTGAGTTTGCCGACGCGCTGTTGGTCATTCCGAAGACCCTGGCAGTCAATGCTGCC
AAGGACGCCTCGGAATTGGTGGCGCGTCTGCGTGCGCACCACAACACATCGCAGAGCGACGTATCGAAGTCCGAACTGCGTTTTTCGGGCTTGGATCTGC
TGGAGGGCAGTGTTCGCAACAATCTGGAAGCTGGTGTCGTGGAGCCTGCTATCAGCAAGATCAAGAGCCTGCGTTTCGCCACTGAGGCTGCTATCACCAT
TCTGCGGATCGACGATCTGATCAAGCTCAACCTCAAGGAAGAGCCCCAGCAGTAGGCTCCGGGTTTCCATTGACAACGGGCAGGTAGCGTCGTCTATAAT
AGCACTCATTTCCCACTTTCTTACCATTATCAACCCACTTTTTTCCTCTTCGCCTGCAGCTTATAAGGATCAGGAAGGCGCCTATGATAAAATCGCTCTG
TGAAGTCGTGCACACTTGACGAGCATCATAAGCTAAAGCAGAGGTGATGTCCATACATATAGATTGCGAAATGCTTCGCAATGTCGTGAGCTACTAATCT
TACAACGCAGAATCTAGTGAACTCCTTTATTATTTACTTAATCAACCGTATGTCTTACTTAAGTCCTAAAGCAGTATTGTTGGAGGTGGCATGCCAAAGG
TGCTGAAAGCTCCACAAGGTTTCTAGTAGTTAGATGCCTCCATATCATTTTCGATCTGGAATATTCGTGAACACATTGCTGACACTACTACATATATGCA
GAGAGTATAGCTCGAGTACGAAAGCTGCTGGTTCAGGCTATAGAGAACGCCAAAACAATGGTCTCTACCGATCATGACCCACCTAATGTCTATATAAATG
CTTCCACCGAGCCCATATTGATGACAACTTTGCGGCTAAACAATGCCATTAGGAGATGTCACTAAGGCAAGCAATACACTAAGTCTCTCGACACAAAACT
CTAGAGATGTGTGGTCACACATACTTCTTTTTCCCAATGCTACGAGATAAAAACCCTGAAGGACCACGATAAACATCGCTGTAGGACGGAAGTATCGTGC
ACAACGACGAGTTCGCCGACTGCCTCTCGGAGGCTGAAGGAGGCAAAGGCACTTCTAGCGGAGAGCCTTCTAGGCTCTCCTCCGTCCAAATCATCGATAC
TCAAACACAAGGACATACATGCTCACATGTTATTTTACACACTCACGTGTCTTTCTCCAATAGTTGAGACTCGTGGATATTCCAGTAATGCCGACTAATT
TCTATGGTCATCACGAGCTGTAGCGAGCTACTAATAAAGTGAGCCTCGTTTGCTGAGGTTTAACCTTCTATTCGGGTCATTTGTGTGGACTACATCACGA
CGCAAACGCTCCACGCTTGCTCGTAAACCAAAGGCAGTCCATGTCGCTACGGGACTGCTATTTAGTGAGCTCAAGTCATCGCACCTTATCAACTCTATTT
ACGCCATACAGCCCATGCCTCGCCTTTGCACACTCCTATCATTACTGCTGGTTCTGCTAGCGTCCTTTGTATCTCCGCTGGTAATCGAGAGGTACGACTA
GATAAATGATCAGTTAGGTCGTGTACATTTGGTGGGGTACTCACTGCCTCATGGGGTTATGCTGTGGTTACGATTGCTTATTTTGGTGCTTTTGTATAAA
AATAAAAAATGACAGCCCCGTCTGTCGACTACTGACACATGTGTACGTTACCGCTGCCCGCCCTTTTTTGTCCAGTATCTAAATTATATGCAATATATTG
TCATCTGATTCCAGGTCAAGCGAGTTTACGAATCTCACGGTACTGGAATCCGGGGTACTACAGGACTACCCAATTGTGCCAGGTTGTTATCCTTTCTTGA
CTGAAGCGCGCTTTGTAATGCTCTGACTTGACGTCGCTCTCTGTGGTTGTTTGTGTTTTCTCCTCGTAGTGTGGCCGTTCACAGCTTGTGAGCCTCTACG
TGGTCAGAACTTGACAGGAAAAGTGGCGCTTGTGCTTCGTGGGGACTGTAATTTTGTGCAGAAAGTGTGGCATGCTCAACGCGCGTTAGCAGCTGCTGTA
GTGGTGATGGACAATGAGCTTCGACACGAGTAGGAACAATGCGGTGTACCGGGTTAAGACTGCTTTTGTGTTCCGATGAAGCTGACACTGCCATTACTGT
TTGATGCGGCTGCGGCTGCTTTAGACCACCGTACCACATTATCATGATGAAGGACGACATGGTCAGCAGACTTCGCATCCCATCAATGTTCATCTCGTAC
ACATCCGGCGAGTGGCTGCTGGATGCCATAAATCGCGCGGTTCCGTGGGATCCACTACGAGTGACAGTTAATGTCAACGGAGAATGTAAGCTGACGAAAT
GTAGCCCAAGATACGAGAA