Description :
From Genome Similarity Track
Location :
contig_3:28036- 29886
Transcript NameFunction/comments
g879.t1hypothetical protein

Sequence
1850 bases(100 bases per row)
GCGTCGTCGCCATTTTTCCAGTCACCACAGCAGGAGTCGGGGGAACGACCATAGGCCCATCCTCCGACTCACTCTCGGCAGCATCGTCCTCGTTCTTGTC
TTCTTCACTCTCAGAGGCATCAGCTGCCTCCTCTAGGCCACCCCTCGTGCGTCTCTTCCTGGCGTAAACAACCGCGACTGCCGCCAGAACAACAGCGGCG
AAAGCCACCACCGCCGCAACCACCGCCAACTGCTCACCACTGAGCCCTCCAAAGCTCGTGGCATCAGCAGCAGCGAACGTCACCGTGGCCGAGTTCCCAG
CTGCACTGTCATCGTCTCCCACCTCCGTCTCGCCGTAGCCTGCATGTGCGACGTCCGTCTCTCCACTTGACGATCCACTGCAGTCCGTAGTCGCCGGCGT
CGGGGTCTCTGTCTCTGTCTCTGTCTCTGTCTCTGTAGCTGCAGGTGTTGGGGTTAGAGTCGGCATCTCTGTGTCAGTGGCTGCGGGCGTTGGGGTCGGA
GTCGGTGCCTCTGTGTCATTGCTCTCTGTAGCTGCAGGGGTCGCCTCTGGCGTCGCAGTCGTCGGAGCGGGCGTGGGTTTGTCCCCACAGTCGTAGATCT
CACGCAGCTGCGTGGTCTGCGTGAACCAGCTCTCGTCGTAGTCCTCATTGCCATCGAAGGAGCCGGAGCTATCCACCGAGTCGTCTCCGCTGTAGTCCCA
CGTCTCACACGCGCTCTCCTGCTCCTGCGGTGCCTCGTTGCAGCCCACAGACGGCAGCACGCAGCCCCACGTGTCCCCATTCACCACCTGGCACTGCGCG
TCCTCAGGTGCCACGCAGCTGCCGCTCCCGAACGACGCGAGCGTCGAGAGGCAGTCAGCCACTGCTACGTCGCCCGCCTTGGGACAGCTCCAACCCGCGG
GGGACGATCCAGAGCCCGCGCACAGCGACGAAGCGTCCACTGACAGCTCGTACGTGGCATCGCGGCATACGCTCACTTGCACGGCGGCGGCGGACGACAT
TCCCAGCGCCACGAACAGCGAGAAGCGAAGCGGCGTCATGTTCTCGTCCGTCGATTCTCCAGAATGGCGATCCAGGTGCAGAATGGCGACCTGATATTTT
CGACTTTGACGGGGTTTCGTTGGTGATTGGCCGGAAAAGGCAAGATATGGGTTCAACTTGCATGTCAAGGTTTGGCTCGCCTGCATAATTGATCGGAATG
CTGCGACCAGCGAGTGGTTTACACGGGGTTCGTTGCATCTTGATGAGTTGGCTGGTCGATGACAAGCTCTGCATTCCGCACCGTTGGGAGCTCTTCGGGG
TCGTATGGTTTTGCTCCGGCTCCGTTGTTGCTGACTGTGCTAGCGTCTCGTTGCGGTCGGTCATTATCATTGCTAAAACCAGCTAGGTCAACCACCTCTT
GCCCGTTAGAGAGACTTGCAGGGTCTGTTGGCCGCCGTTTTTCGTCTATAAGCCGCGTCATTATCTGCGCCATATACTCGCACGCAAGCTGCTGGTCTCC
TCGAATCGAAGGTGAACACTTCGAAGGAGCAACGGACAGTTCACCAGCAATCGGCTCTTCAATCGCCGTCGCACGAATGTTTTCTCCTAGATTTGCCTCC
GCGTCGTCAGCTTGCTTCACTGCCGCATGCATGGCTTCAAGAGCCATCTCTAACTCTTCTGCCGTCTGTTCCTGCAAAAATGCCAAATCCTGCTGCCAGT
TAGGAAACACACATTTCACCACGTCTGGAACCTCCTCAACGCCTGGAGTCCAGACCGATCGTTGATCAGCAGTCGCATCCGGAGCCACGGGTGGAAGCAG
AGCCTCTGCTTCAGATTCCTCTCCACGTACAACATCAGCGTCTTCGTTAC