Description :
From Genome Similarity Track
Location :
Scaffold_15:28035- 30075
Sequence
2040 bases(100 bases per row)
CTTTTCATGACTATTAGCTTCTGTTTGATGTGGTCGGAGGGAGACGAGGCGACATTTCCAGCCGTTTATGCGGGCTTCGTGGCGATCAAGTACCACATAA
AAACGCTCAATCGCACCGTGATGGACGCTTTTCTTTTGAATGACATAGACCATATGTGATCACTCTTATTCACTAGCGCTTCGAGCTAGTTTCACGAAAG
TCCATGGTCTTACATTCGTAACCGATCCATTATTTAGCAAGATGCGAGTCTCAATCGCCGCTAAGTTTGGAGAGCAATTTCTGCAACTAAGGAGAGCCTC
GTTCAAAGAGCATTCAAACGCGGCAATCTCCCGTCTTTTAAATAGTGACGAAAACCTGAGTCGATCAATGTTGAGCGAGTTGGCCCCTTTCATCGTGCGC
CACAAGGAACAAATGAAGACGACTTCAGTGATATTAAGTTCAAATTTCGGAATTTTGGACGTCATATGACGACTTGTGCTACGGATGCATAAAGAGTCCG
TTCTCTGCTTTGCTCAAGAACGCTTTCAGAGCAAGCGAAGAGGAGCGGAATCAACAGGCGTCCAAGCGCGTTCACAGTCGCTCATGTGCTCACTTACAAA
AAAAAACAAGGTCGAGACCGGTACTGCTATTCTTTGTAATTCAAGTCAGCTCGACTACCGAGTCGATACAACGCGAGATACCAAATGCTGCGGGTGGCTA
CATCAGCTCGATGATGACAACGGAGAAGACTGAAGAAAAGACCCTGGATAAGTAAGATGATGACACTGGAAGCATGATTGACGAATTTGACCTCTTGGAC
ATCTCTGGTGGCACTGAACGCATTGCTGACAAGAATATCTTCGACGTGGAGGTGGAAGACGAGAGTATAAACTTCAATTAAGGTTTCCCAATTCTGGTAC
AACACACTTTGGTATAATAGGGGTGTAAACGGTATTATAACACGACGTCGCTTATATTTCAATTATACACAACCATTGGCACAACAAAAGCAACATGCAT
ATTATAACGAGGACTGTTATGAGCCGTTGCGGTGCCAGAACTTCGCGACGGTCGAATTAGATCGTACGTATGCTAACATAATGATGATCTCAAGCTACGC
ACGATACTAACTACGTGACACTTTTTTACGATGACAGGTTCGTTGTCATAGCGCAAGAGATACTCCTTAAAGGTCAGATTCAATGGGATGGGGTCGTCTC
TTTGTACAATAAAGGGCAGAGGCCAGAAGAAGCCATCTAGAACGTGACGCACTGAAGACTAAGTTTAATCGAATAAGGGCTTCGTCAGGTGTTGTCGCGG
ACCTACCACATTGTCTTTAAGCGCAGATCTAGATGGTTGCTGGCGTCAGAACTGGGGACGACAGTACAGGTTTGTCCCTATTGTCTGCCAAATCCATCGA
TCGGCCTCTCACCCTTGTGAAAAACAAGATCCCAGTGCAAGATGAAGACTAGGATGAGCTGACATATCTATTCAACCAAGGTACAGCTGGAATCGTGCGG
ACAGCGGCGCACCTATAAAATCCTTTGTTGATCTTGGCAACGTCCCGAAGCCGACCGGGGACCATGACTGCACCGAGGAGGTGAAGCGTGCAAAGCGTGC
CAAGTGGCAAATTAACACCATATTAGATGCAGAAGATATGAACGACACAATTTACGAAGAGAGCGACAGAGGCTGCGCGACATTTGATGGCAGCGCAGAG
TGAGACAAGTAATACGGAGGCGACTGGACGATACTGAAAAAGAACTGGAGTGCCAAGGACCAATTCGAGGAACCAAAGGATAAAGATCAAGCGGCAGCAG
CGAACCTTAAGAATAATACGGTGGGTTCATCTGAGAAAATTATGGTTTCTGCTTCACCTTTGTTCTCATTTTTGCCAGCGACTTCACCATCCGTAAATCG
AACGCCCCAATGTCTCGTTCCTACGAAGCTCAAGAAACGTGCAGAGAGTAATTCCGCTGCACCACCAAGACTCGCAGAGTTGTCTGTCACTTCTCCTCTA
TCGCTTACACCTGAGCCGTTAAGCTAAGTAAGTGTTCAAT