Description :
From Genome Similarity Track
Location :
scaffold_104:28035- 29851
Transcript NameFunction/comments
Pl_109673hypothetical protein PHYSODRAFT_523206

Sequence
1816 bases(100 bases per row)
AATCCAATGAGAGTTGCAACGATCACTCCATGCCCTACCAAACCCCACACGTAATATGACATCTCTAGTGCTAGAGGTTTGGTATGCCTTAAATCTGACT
TGTTCAGCGATGTGAGTACGTAAGACTGACCAAATGCACTCAGAAGTTCCCCCAGTAACGAAGACTCGTAGCTAAAGAGCAAGCGTTTGATAAATAGCCG
ACAAGTTTCTCGAAGCCAGCCAACATCCTCGATGAATTCAAACAGCAGTAAAAGAATACCGGACAAATTATATCCAAGTGATACGTATTGAATCCAAGTA
AAAGACCCATTGGTAGCAGCGAGTAGAAACAAATCGCTCATGAGCCCTTCCAGCAACATATACAACAAGATTACTCGATGGTAATTCTTAGCTCCGTGCG
CCGAAAGGCGTAGACTTTCGTGCACAAAAACTGTAGCTGTTGCTCGCCGCAGCCTGACGTCCACTTTAATGCATGCGTCACCGTAACGTTTGCACGAAAT
ATAGCTCCTGCGCAATACCAAGCCGCGAAATATAATCCAAATTCCTCCAATAATGCTGTAGTACAAAGACCATCGGTAGGCGTCACTACCAGGATCTTTT
GCTAAGGCTACACCGTTGATATCAAATGTACCGAGTCCAGCAACTTGGGTATACGCAGTGCGATCTGTGACACAGTAGGTGCCAACGAGCTCATCGTAAT
ATGAAAAATACCCAATGCTGCCATGATAGAAAAACAATTCGACGGGAAAACTATCGACTGCACAGTTTTCTGGCGCTGAAAAGAATGGTTCCACCTTCAC
ATCCTGAATCAAGTATCTGCCGTGAGAATTGTATTGCGGAACGACATAGTGACAAAGTTGACCATTTTCCAAATTGTAGTAGTGGGTAACTTCGACGTTC
CACCACACGTGCCCAATATGAAATCCTTTCATCGGGCACTTTTCCGATAAATTATCCGCCCTTGGCTCCGTTCTTGATGGAACTAATAGATTCTCTGTGA
TCTTGTGTGGAGTTGCAAATTTCAAATAGCTGCGAATCTGCAGGAAGAAGGGAAACACCCCGATAAATAGCCACGCTACTAGTAGCTTCCGCTTAGCTGT
CATAATACTGATGTACCAAGTTTGTGCTGTCATTTCGCCTTGTAAAACTCGTTGAAAAAAGAGAATTCTCGTAAGCTCCATTGCTGCTCTCAATTCTGAA
GCACTCAGCAGGTTTGCTTGAAACGGATAAATCTCACCTATTTGTACTACAAATAGGTGAGATTTATAGCCATGCTGAAGTCTTCATCTCGGAATTGTCG
CTGCTTACAGGAAATATGCTCAACATACCACCAATTACACATTTGAGTGATTGCTGCCGTACATCACGACCACAATACCGGGGTACTTCTCCTACAGAAT
AAGATTATCTGTGTTCGTGCTCATGCTTTAACGATGCACAAAAATGAGAATGTTGTCAAATTCGGGTCGTGCAGCAGCAATTGGAGCCACTCGTTCCATC
GATTCTTGACCATTTACGCTTTCGAATCCAGTGTGGTGCATCTAACGACGACTTCCACTGAAAAATGTGATTGCGTTTGAGGAGAGTCTTCATACTCCTA
GACTCATAGAGTCCAAGAAATAACACATCACAATTACGACCATATTATCAGCGTCCATGGGTGAATATTCGTACCGACATGATAAATGCGATAGTAACCA
ACATAGCTTCACGAGTACTAAAAGATGCTGCAAGTTGCAGCCTGCAATAGCGAGCTTTTGAACCTCGAACATTAATCGATCAGATGACTTTGCCACATCG
CACTTCAAAATTCTCC