Description :
From Genome Similarity Track
Location :
contig_12:280319- 281967
Transcript NameFunction/comments
g3778.t1hypothetical protein

Sequence
1648 bases(100 bases per row)
GTCGCCTGCAGGGGCTTCTTATCGGGTCGATACCGAACGAACCGCGGGAACCGAAGCGCTAAACCTTTGCGAGCCGCAGCAGCAGAGTCACCGCCTGTGG
CTGCTTCGGTGCCACAAGTGTACGAAGGAGACTCGGTCAGTTGGGTGGCTTTGATCTCCCACACCTCTTCTGGCGAGATCCAAACATCAGGATGGCGACT
CCGAATCGCATGAGATTGGTATTGCTCCGGCACCTCGTCGGTCTCTGGCAGAACTTGCTTCTGAAGGCGAGCTGCCACTTCCGACAGCTGTGCATCGGTG
AAGCCTGTGCCGACCTTCCCAATCGTCTACGACAAAGCAAAACAAGACCACCATGAATTAGTAAATATAGCGGTATCGGCATCAAACGCTTGTTCCGTAC
CTCGAATTTGCCGCTGGTCGAGTTGTAGGTGGCCATCAGAAAGGATCCGAACACGCCTGCGCGCCGGCCTTTGCCATAGAACGCGCCGATGGGGACCAGG
TCCAGCGTGTCTGCCAGGAATGTGCCGTTCCCGTTAGTTTTTGCTGCAGTAGGTTTTTGTTTTGATGTGGTCGGCTCATCCGATAGATAGTCATGCTTGA
GCTTCATCCACGAATATGACCGCCGGCCAGCTTTATACTCAGACGCTTCGTCATCCAGTGCCTTGATCATCAATCCTTCACAACCACTGGCCACGGCTTG
TTCAAGACACCCTCGTACAATTGCTGCCTCTTCACCTTCTCCAGAGTTCTCGCCATCAGTTGGAATCGTATCACCGGCCGCCAACTGTATGTCAACGTGC
TTTACGAACTCGACATATCCAGCCTCTTCCTGGAGCAGATCGTGGAGCAAGGCTCGTCGTTGTCGTAGAGGTTTCTCCAAAGGTTCACAGGACAAGAGAA
TAAAAAGTTAGTTGAATGATACGACACACAAAGCTCCCCATTCACATACCTGAAGGAGGTTGGTGCCATCGACAGCAAGCATATCAAAAAGAAAAAGACA
AAACTCCGTCGTGGACTTCGTTTGAAGCACTTGGAATGGGCGAAATGTGCCCGTCTTCCGATCCAATGCCACCACCTCGCCCTCCACTATCAACGAGGAC
ACTGACGACGACCCTTGTTTTGTTGAGTTGCGAGCTGCCACGCGCTGCTTCAAAATATCCAGAAGGGATGAAAACCTCTCCGTGACGTCCTCCATATTTC
GACTGAAAATCCGCCCGACTGAGCCTGAGCCATCACTACTATCTGGCAGCGTCAAATGCGCCTGCACTCGGGCACCATCATACTTGTACTCGCAGGTGGC
TGTTTGGCTTTCTGTCCTCCCCACGCGATCCAACACCGCCGCGACGCTAGACATCGGATACGCTGACATTGTCAATACTGGAACACCCGCTGCCGGGTGA
GCCTCCTCATGAAGCCAATCAATTCTTCTAGAGATGTCCGCTTGACTCTGACTAGCATGCACCAAATCAGCCAGCACGCGATAGTTGGGGTGCTGTGCGT
ATGCAAGAGTAACACAGTCCACCCAGTCCTTTTCTCGTGATGGAGTTGCAGCACTCTCCTGCCCGTCATCGTTATCCTCAACAGAGGGCAAACTAGCCAT
TGCCAATGCCGACAGAATCGACTTTTCGCCCATTCCGATGCGCAGATT