Description :
From Genome Similarity Track
Location :
Scaffold_1252:2803- 6312
Sequence
3509 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNATTTTAGTGGGGGGTGTAAGGGTTTTATTCTTTATTAAGAAGGCCTTACTCCAGAAGAAAGAGTATCGAGTGAGCAATCCTCCTTTCTGCATCAT
AATGCATGAGAAGCGTGGTCTGCACCGTCGCATGAGCATCTTTAACGGTCCGCGCCTTGTCCCAGACGGTGAACGTGTCTTCCAACGGTCGCTGAGTCTT
CCGCGAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGAT
TCAGTGACATAGGGCCGTATCCGATACTTGTTGAAAACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTAGCGTCTCCGTACATCACCTGACCGAGGG
TTCGTCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACTTCGGAGAGATCACTACACCACAACTGCCCCTGTCGCAAT
GGAAGCCACGGTACTGGTGCCCGTTGTGACATTTCTTCATTCTTCAATTCACCATCTCGCCACCGTATGTCCAAGCGTCTGAATCGAGTCGTGTCCGACG
CGTTTCAGCGTCTCAATCCTCGTAGACGTCGCGAGCGTGAGCAGCTGGAGGTACGTAAGCCCATCCTTCTCTTGAATCATCGGTACCTTGCTCATCACCT
CGCATTACTCGACTTGTTTCTCAGGAGGGCTAGACCGAGGGTTCGAACGCCCCTCAGTCTGCTGCACTTCCTTCGACAGCAGCGTCATCAACCGACACTC
CGGCGCCCGCTGCCCCGGACTCTTCACTCCCTGTGGTAGCTCCTGCAGCACTCCCCGTCGTCGCTGAACCCACGGAGATGGCGCCTGCTGCTCCTCTCGC
CCCAGCTGGTGTTGAACGAGGTCTCGCTGAAGAAGCTAAAAAGGCTGGCCACGACAAGGAACGCTTGAAGGAACTGAGAGCTGTGTTGAAGAAGCTCTTC
AGTGAGCGCGACCGTCGTGCCGATCGTCTTCGTAACAAGTACCGTGAGCAGTACATGGCGTGGAGTCGTGACTCGGTTTCCTCTGGTACTTCTGGCGCGT
CGTTCATTCGTCCCGAGTTGCTCTTGGAGCCGTCGAAGCCGTGGTACCCCATTGAAAACTTGTCATTCGCACCTCGGACATCTGACTGGCTTTCCGAAGT
TCCGGCTCTCGACGCTCGTCAGCCATGGCGTACTGGATGGATGAATGCACCGCATCAGCACCCGTACAACACTACGTACTTCCCGTGCCAGCGTAATCCA
GAGCTCTTCAATCCTCGTGGTACGCGTTTCGTGAATGTGTACCGAAGCGTGATTGTTGACCCGTCTCTGGATTCTACCGAACTTATTCCGACCTGGCGCT
TAGTGTTTGACTCGCCACCGGGTACTCCACGTCCCGCTCTGGCTGCTGCTTCTGTTGAAGCTGGTACCGAGGATTCGCAGGGTCCGGCTGTAGCTCCAGC
TGTCGAGGCTCAGGTTCCTGATGAAGAGGAGAAGGAGAGTGGTGACTCGACTTCGTTGACACTCTTGGCCACCGCGGCCAGACACTTGGAATCGATTTGA
ATCCTCGCTGCACGTTCTACGACGTTCTCCAGCATCTCAGCTAACTGTTGAGGTGTCCCGCGTGACTTCGTTTTCAGTGGTCGCTCCGCGGTCGGCATTC
ATGTTTTCTTATTCTTAATCCACTTCCACAGCGTAATCATGTTCATGTTGTTCTTCAAATGCATATACAATTTGTTGTTGCAGTAACGTTTTTCGTCTGT
TACCACAGGCTGCATCGCCCTGTGGACAGTTCACACGTGATCCAGTCACGCTAGTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCT
CGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGATAAGTTGGATGATGGTTCCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCGCG
TACAGCACGCTCCGTGCTCGTCGTCAGTGGCGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCTTCA
GGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACCAACCGAGTGTTCGGTCGACTGCTGAACTCGTTGACAGCCTTGAGTC
TCGACACATGCACTACAGGGTAGAAGCGATACCCACTTCGGTCAGGCAGTTCCAGCTCGTACGCAAACGCTTCCACCTTGCGCTTGATCCGAAAAGGTCC
ATGTCATCGATGAGCTAATTTCTTTGTCAAGCCCGGTTTGACGCGCTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCT
CTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCTGTCGACCCAGAG
CATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCCTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCA
TGCCAGTGTGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCGACGTCAACTGCGCATCCCAACCATGAACGAGATAGAACGGC
GTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCCGCGATTTCGCCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCC
GTACGGACC