Description :
From Genome Similarity Track
Location :
Scaffold_2054:2803- 4053
Transcript NameFunction/comments
Phypl_g14610hypothetical protein

Sequence
1250 bases(100 bases per row)
TACACCGCGCGCCAAGTTCTTATGAACACCCATATTTTGTCCTCTAGCTCAGTCAGTTTTACGAGTTACCCCGAGCTATTTGGATATGTCGTTTGCACCG
CTATAACACATCAGAGGCTTGTTTTAACGCCTGGGAAAGAGCAGTTTAGAGGGGGCTGCCATACAAGTGATCAATTATGACATGGCGACCAATATATGAA
CAGCCCGCAACCATAGTAAAACCAAGTCAAGCAGAATGATGGTAAGTATAATGGCTACATCAATAGTGGGTTTTGTTCCTGTGCTTCGTAATGCACTACT
TGCAGCGGCAGGCATGGACTAGATCAGTGTCTTGAGCACGGACATCTCAATAGCGTCCCAGGTCTCGTAAAGCGCAAATGTCAACTCACGCACGCTGCTA
AACGGCCACCTATTTGCGTAAACGTGTCGACTCATAAATCGACTATAAGTTTTCGATCTGACTAAGATCGGGCGAGCGGGCAGCCCACGAAAGGACATGA
ATCACCGGCTCCGCAAAAAAAACTCCTTGGTTCGCTTGGAGCGGTGGATGGACGCACCATCTTGTTGGAAGATGAAATCCGTGCCATAGCGCTGGTGGGC
ATACCGCAAGAAAAACTCGGACAACGTGTAGACGTAGTCATCCGAGTTCTGCCTGCCGTGAAGCACCGCCAACTTGGTCTTGCCGGTGGCGCTGAAGCCC
GCCCACACCATGACTGAACCACCGCCGGCATGCCGACGCTTGGTTTGCCTTGGAGGTCGGCGCAGGTCACGCCAGTACGTCTGGAACCTGTCAGGTCCGT
CTAGATTCCATTTTTTCTCGTCAGAGAAGATAATGGTCCACGACCTGAGGGGTCCTCATACATCAGCATCTCCCACGCCCATTCCTCTCTTGCACGCTTG
TCTTCAGCCGATAGGGGAAGCGTGTTGTCCATCTTGGTATAGACAAGCCAATCGACACCAAAAAACACTCGTTGAATTGTACGCACCGATGTCGACAGCT
TTagctcgagcttgagctgcttggccgagagctgctccttggctGCAGTGCGAatcagcagccgcagctcgcggtcCGACTGCGACGTGGGTGGGCCTGG
CCTCGTGTGCTGGGTGGGTGGCACATACAGCACCTGCTGAACTGCACCGGCCGAGTGTTTGACTTGGCGTAAAATCTTCCTCAGCCCGTAGCCTACCTCA
TGGAGGCCTTGGATTCGCCCCCGATCGATGTCCATTAGTGGTGGTCCCCT