Description :
From Genome Similarity Track
Location :
Scaffold_154:2803- 4026
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_154-snap-gene-0.20HECT E3 ubiquitin ligase

Sequence
1223 bases(100 bases per row)
TCTACTCGATTGTAAAGCCTGTGACTTCCATCTGAATCACAAGCGAGAGTGCTATGCGCAAGTCCTTCTCAGCGTCGTACTTGGGGAGATCAATACTGCA
CCAGCACCATACTTTCAGTCAGTCATCAGGAAACACATCCAAACAACTCTCACACAGATCGTACCGGTTGAAGCATGTATGTGCACGCGGGTACAGACAC
TCATCCTTGGTGACGCACTGGATGGCGAAGGGGCAGATGCGTCCGTCATTCATCGTGAGCGCCTTGAAGCCCTGGACCGGCACGCGGGCTGACCCAGTCG
TGAACTGCAGCAGCCGCGCCTTCTGCTCGTTCGTGAACTGGCCCACAATGTTCCAGAACCAGCCCGTGACGCGGTCGTCGCGATCGCCGACATAAATAGT
GTTCTGCTGCCAGTCCTGGATGTCGATCTCTGGGATACCGCAAATCAGGAGCTCCAACTCCTGGTGGTCGAACACAGAAAGGAGCTCCCGCGGGATGATC
GCGAACAGTCCCTGCATGAGCGACGCCAGCTGCTGGGAGATGCTCGACGCCATGATCCACTGGAAGCGGAGGTTGATGTACTCCATCTTGTTCTCATCCG
TCACGGCAATGTTCGCGCCGTTCGGCACCAGCTCGACGACCTTGCTCTTCTCTGAGTGCTGGTCAACGTTCACACTGCAAACATACATCACACTGTGAGC
ACCTCACGCCAAACAACCATCGCAACGATCCCGAAACGTACGTGAAGTCCAGGGCGAGCGACTCCACGCCGGTGTTCTCGCGCAGCCACTTCAAGTTCTT
GTGCAGATCATTGTCGACGAACTCCAGGTCCGAGAATGTCATCGGGATACCGAGAATATGCTTGCACACCGGGAGTGCGAGGTGCGCGTCGATTAGAATA
CCCTCGAAGAGTGCGCGTCCGATGAAGCGACCAATTGCTTGGTAGTACTGTGCAGATAAACAATATTCGTTAATCAGTGTGCGACCGATCCAACGTCGAG
CAATAGGTTTGGAGCTTACCATGAGATGGTCGACACTGGCCTCGCTCGACGCAGGGTTGATCATCAAGCCGTCCCCGTTGCCGCTCGTGTAGAAGAGGCC
GGTGCTGTCGTCAAATACCTCCTTGGTCATCAGGGTAAACCACTCGCGGACGAGCCCGCCAGCATCAACGCCAGGCTCATTCGCAAACTTGATCCGCAAC
GACTGGTGCAGCTGTTCGGGCGT