Description :
From Genome Similarity Track
Location :
Scaffold_224:28028- 35713
Sequence
7685 bases(100 bases per row)
CCCATCCGTGTACCAAGTAGAACGGGGTATCTCCCCGGGTCCTGTCCTGTGCGGTATGCATTGCGAAGGTAAGTCGCTCTGCGCATTCATCCCAGTCCCG
CTGATCCAAATCCTGGACAGACACCTTGAGCGCCCTTGTTATCGTCAAAACCATGCGTTCGGTAGATCCGTTGGCTTGAGGGTGATATGCCATCGTTGCT
CGCTACCTCTGCCCAAGGATCTTGTTGAAGGCTCGAAAGCAATCGGACATGAAAACTGGCTCCCGATCATGACGAACCGTCTCACTAGCCCCGAATCGGC
GAAAAACACATTCCTCGTAAGATTCGGCGATGGTCTGTGTGGTCCTGGATGCGCTAGCCTTGGCTATCACATATCCGGTGAGCAGATCCACCCAGATCAA
CAGCTCGGTGTTTCCTTTAAATGACTTGGGTAGCGAGGGAATGTGATCCATCGTTATGATTTGAAAAGGGTACGTCGCTGGGACGTCACCTAGAGGCCCC
TCTTCGATGGTGGGCCTGCCTTTGCCTGTCTCACAATCCACGCATTCGCCGACATATCGATGTACACTCTTGAATAATTCTCTCCAGTGGAAACATTCTC
GGATCCGTTGGTAGGTCCGACCGACTCCCTGATGTCCTCCTTCTAAGCTAGCGTGATAGTGATGTAGGGCGTCCTGTTGCAAGGTTTCCGGCATCACCAA
TCTCATCAATCCGTCTCGATCCCCGCTGACTCGTTTCGTAGGAGGGCAATAGAAGAGCAAATCGTTCAGATCCACTGCATAATCCGTAACGATAATACTG
TAGGATTTGGCGTTTTCCCGACTCAGGTCTCGTACATCCCCCATTAGATACTTCTTTAGTCCCAAGATACATGTCTCTTCGTTTTGTGCTTTGAGAATCC
GCTCAATTCGAGCCCCCTTTACGTACGCCTCATCGAGGATTTGGGGGCTAGATCTAATCCTTTCTCTGGATCTAGTGACAGCAACAACCTGGACAGTCCG
CTCCGTGGACCATTTCGTCTAGTCGGTTTTGTGTGACGAGATCCTGGCGCTCGGCCTCTCTCTCCACTTCGACCCCACCTAGATTCCGTAGAGCAGCACT
TGCCAAGTTGTCCGCTCTTGCATTCCAATATCGCTTGACATGTACCAGCTCGTGATTCATCCACCCACATAGGTGCGTTACCACCTTCTGACGTAGCAAC
GTTAATGCAGGGGATTTGCAGGCGATTTCACCTCGCACCTGTCTGATTACCAAATTTGAGTCTCCACATATCACCAGCCTCTTTTTATCATCATCCTTTT
GTAGATCCAGCCCCAACAGGAGTCCGTTATTCTCCGCTTCATTAACGGTAAGGCCTTCCGCATACGCAGATCTGGCCCTTACCACTTCCCATTCGGGCAG
TCGCCATAGGATTGCACTGTAAGCACCTCCTCCGCGTCGTACGCGGGCGGTTCCATCGAAACTTAGAGCGTATAGATCTTCATCCACTTACACCATCGGG
ATCGGAATCTGAGTCTGGCGTTTGGGCTCTTTCTTAGGAGCGATGTTAGTCAGCGCTTCATCCATCTTGGATCTGGGCGTGATGCTCGCTGCCAAGACAC
CTAGAACCGCTTCTTCTCCTTTTGAACATTTAACGATCTCTTGTGCCCATGGTGAGAGCAGTGCTACCCATTGTCCCAACCGTTTTTGTACACCGGCCGA
CTTAAACATCCATGCGAGTGTGGAATGTCGAGTCAGGATCCGGATGGATCTCCCCACCAGTAGTTTAAATTTGAGACACCACCAGTAGTTTAAATTTAAT
CCAACACCCGTAAAAGTGCCAGTATCTCCTTCTCCACTGCTCCATAATTCGGGCTATAGCGTTCGGCTGACGAAGGTAACCGGATGACAGATCCCCTCAT
ACGCTTGTACCAAAGCCGCCGAGATCGCTCACTTGCTGGCATAGCCTATCACCGTAGGTTGGCGTTCTGGGTCAAAATGGCAAAGGACGAACGTCGCCGA
AACCCTGTTCCTCAGTTCCGCCAACGCATGGTAAGCTCGGATCCACCGAGGTTCACTTCGTCTGAGATTCCCTTTGTCCCTTCCTCCACCCCCCCCCCTT
TTCGTCCCGCGGGGGAGGGGATCCAGTTTTCTGCTTTAAGTCGCCTCCCAAAGTCGCGTCATGTAGATCCACGGTCTCCAGGGCCAGAGCTCGTTGGATC
TTGGTCCGGATGGCCGAAGTCGCCATTGCAGCAACGTCCACCTCTCTTAATTCATAGAGGACTGCAGCGAAGCGTGCGTAATTCTCAATAAACCGACTGC
CCAAGAAAGATTGCATCGCTCGTAGCGACTGCGGGAAAGGCAAATCCGCCAACGAGGACAGATCCTTAGGATTCGCATCCAGTCCTTTCTTAGAAACTCA
ATGACCTAAATAATCCCACCTTGCTCATTCCCCTAGTAACCACACTGATAGAGAGATTCCCATTTATTGCACGCCTCATGTGGGGATGTCACTCTTTCGC
ACAGCTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATATAGGATCTGCGCCCCAGCTCGGATGGTGTCCCCAGATCACCTGGCTCGCCTGCTTC
AAATGGATCTACTTCCGCATTGCCTTCTCCGGATCAACCCCTTTCTGGCCCCGGGATCCGAGTAAATTCATAGAGGGCGTTGTCGATGAGACGTTAATAG
ATCTGGGGTGCGTTTGTTTAACCCAAACGACATCCGATTCCATTCGGACCGTCCAAATGGCGTGATGAATGCGGAGATCGGGCGAGCTCGTTCTGACATA
GTCACTACCCAATATCCACTCGCCATATCTAAAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAGCAGCTCATTATCAGAGGCATCGGGTATTCCAT
CAGTCTGGTCAAACCATTAACCATCCGATAATCAATACACAAACGTATATCCACCCCGTTTTTCTTAAGAATGATCACCACTGGAAATGCCCATGGGGGG
TTGAGAAACCGATGATATTGGCTCGCAACAGACCTTTGATTAGATACGATAGCTTTTCACGGAATTGGGATGCCGCGTTCCGCACCCTTTGAGCAATCGG
CTTTGCATCGCCGACATCAATATCGCATTTGACTCTGTGTGCGGCTGGTGGTAGTGCATGACCCTTGCCAATTAGCAGATGTCGGCTCTCCCATATCTTC
CGACGTAGTCGTTCCACTTCCGCGGGTTCGTTCGCTCCCAGATCCACCTGGATATCGTCGATCGTGACTTCCTCCGTAGTCAGTGGCACCGGGATCACCG
CCATGCATTTCCCAAGGTCTTCGGCATGCAAATCCCGCCTTCGTGGTAATATTCCTGTTTATCTTCTGTCTTTCTTGGATCCACCACTGGATCAGGGCTC
AACAATTTTTCTTCCTCCATTGATCCATCTGCTTTTATTTTGCCGGGTACTCTGACGTCTGGGCAAATACCTTCTGGATCACCTTGGTCTTCGGTTGTGC
TTACGTGCGACGGCTTCAGTTTAACCAGTGCCGACACCCTCAGCGGCGGTCCAGGCGTTTTATCCAATGAAGCCTCCTCCACTTAGATCCCAATCCGACG
ATCTCTCAGTAGGATCTTTCGCGAAGCTGGATATGAAGGTTGATCCACTAAGGGATCAGTCGGCTCCGCCGGGGGTTCCACCTCGCCGAGAGATTCAGGC
TCGGTAGTCGCTTCATACGCCAGATTCTGCCATTCTATATAGCGACGTGATCTAACTGACACGTACCCAGGCCGCCTAGGGATACCATCCTTCGCTAGCT
ATCGCCCAATTTCTTCATAGCGGTCTAGTAATAGCCGATTGTCGCTGACATTCGTAACCTGAAGATACTGCGATCGATCTGGACCTTGGATTACTGTAGG
CACCCACGTCTCGCCCCGTGTGACCCACCGTTTCTCGTGTTCCACCCATTTCTCCCGATCTGGCAATTCCCAGGTTTATCCGGGCTCGATCCAAGTCGTT
TTGTCTGCCCTTATGATCCTCATCTTCGCCCCGTACAGCGGTCGTCGTCCACTGAGCTGGATCCGAATTTCATCTGGGAAACACAATGTCCCATCTACCA
GATCCAACCTTACCCCGGCTGGTACCATGGAATTCATTCCAAGAATAGCGTCTTGACCAGCAAGATCTGCGACCTCAATATCGAACCAATACACTAAGCA
ACCCGCCAGCGTGATTTTGATTCGTGTCCTCGATACACGCCTTCACCAATCCCTACACAGTCTTGGATCCGACTCCCATCGACTTGGCACCCAACGTGCG
AGCAAAGGCGGTATATAGTATTAACACCTCGGCACCACTATTTAAGAGCAGAATCGCTTTTCCATTGGTGATCTTGCCCCCTACCTTGGCTTGTCGGAAC
CATTTTCCTGGGGCACTGTACTTCCAATATCCACGCGATTCCCCTGTCAGCAGGTCCATACATTCAACATCCTCAGATCCACGGGATCCAGTGGCCTGGC
ATACCTTGGGTGGCTCTGCGATGACCTCACCCTTGGTAGGCTCAAACCAGCGGCCATCTTGCTGTTTCTCCCAATTACCGCGCCCTTCTCCCCTTTGTAG
ATCCAGGGCTGAAGAGACTTCGGATCTGGTAAATTCGTCCACTCGGCGCAAGCTAGAGACCTTGACAATTGACACTTCATGTAGCTTACGTGTATTATTG
ACTGGACCTACAAAGCCTGCTACCTGGATCTAGCGACGGCTTGTTCACAAATGCATAAAAGCAGTACCTAGAAGGCTCGGCTCGTACCGGATTCCAACCC
GGCGAGCGTCCTAGTTTAACATCTTTTCTGCCACCTCTGGCAACATTCCTCTGTGCTTGGTTCGACCGAACTATTGGCGGATCTGGATGTAGAACGCTTC
CATCGGGCACTTGCCAGCATCGGGGATCTCGCCCCAACCCCGACACACGGAGGAACAGTGATCCCCGATATGTACACTTGCCGAAATGAACTTTCTTGCC
ACACTTCTCACATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGCCCGGCTGCCCGATG
GCCAGTTTTCTGGCTAGCCCCTCCAGCAAGTCCGCAAATGTCAAATACTTTTCTACATCTGAAGCTTGATGTCTCATGAGGTCTGACTTGACTTTACTCA
TTCATGTTCGCTCGCGGTCTTCGCCTTGATCCTTGCCCGTGAACTTATTCAGATCCGATATGGCTGAGCTCCGTACCCTCTGAATCATAGCCGATCCATC
CGTCCCGGATGCAGCCGTTGCTACCGCCGCTGGATGGGACATCCAGATCATCCGGGTCGAACTCATCAAGGGCGTTGTATCCCTCTACCGACTCCATTTC
GACGTCCCGTGCTCCATGGCTTGAGCACTTGTGTTTGTGGCCTGGGCACCCTCATACCTTGTTTGGCCAGGAAACGACTCATCGCAATTTCGAAGTGCCG
TTGTAAGGTATATAATGAGGTGTCGGAGAATCCAGTAGCTGTAGCTTGGTCCACCGTCGGGGAGGGATTCGTGAGACGATTAGCTTGAACCCGATCCGAC
CATAATCCAGCTGGCGTCTTGCTGGGTCTGGCTCGATGGCATCAGATTGCGGGTATGGCGCCCTGGATTCCGTGCCTTCACACTTGAGGGCGCCTCCTGT
GCTGGATTCTTGCCCGCACTTCCTGCATTGACCCCCGGAGGGACCTAAGGTCATGCGTCGCTGCTCGAAAGACGTATCTGATCCATCCTCAGCCGCCGAT
TCGTAGTTGGAGGATGCAGCTTCGGTGATCTTCAGCGACGACACTGCATCCATGGTCTGCGGTTTTTTACCGGCGATGGACTTGACACTGACGAAAAGAT
TCCGCGTCGCCGATACTATGAGATCCCAGTCTAGCTCGAAGATATCCTCCGCATCGAACGCATCAGCTACGATGCCTGAATCCGTAAGCAGACGTAATAG
ATCATTGCCTACCACCAATTGGTTCGCCGTTTTCGTTAGTGCTCTCACCGGCTCCCTTGGACCTTCGATCTGTCGTGGATTCAGGATCAGCATGGCAGGA
TCTTGATACAGAAAATCGCGTAGAGCTTGGTGGCGTTTACAACCCCGAGAACCTTGTCAGACCATCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTC
TGGAGCTTGCATTTTCTACCGCGTTGTCTTACTCGTATCGGACTTCTTTCTCATCTTTTCGACTAGCGGGTAAGGGTTTAGATACGGTGTTGGTTTGACC
GGTGAATCTGCAAATGCAAACCGTTTCGCCTTCACTTCTCTTATTTTGTTAGCGGATCTTGACTTGCGTCAAGATTCGCAGGGGGCCCCGAGGGGACCTG
GGGAGGATAAAGAGTTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCTACAGACTTCCTCCCAGGAATCCATCGATCAGCGGATCTTGTT
TCATTCAGCAGCGTCTTCGTCGATCCGCCCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGTGCATCTTCTTGGGACTCACGGTGAAATCCCG
AGTCACCAAAAGTTCCGGGCATGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGTGAGATTGCTGGATCCAACTTACCAACAGCACCCAGACACC
GACTCACGGAGGGGTCCCCCGATGATCCGTGATCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATAATGCTCTCTCGGTAACTTCCG
AATAGCTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACATGGGGATGGGGTGGAGCAGTAGTGGTCAGATCTTCACTATGCGTCCGCAGTAGTTGTTTC
TGAATCCCAAGCGAATATTTGAGCTTGGTGGATCCAGGGTCTAGATGTGGGATCGTGAATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTTGCCTTT
GCGTTTTCTTTTACGTCGTACTTGCCGCCTCCTGTGACGGGATCTTAAGAGTAGAGATCTTCTTGGGTATACCCGGCCAAGTTGT