Description :
From Genome Similarity Track
Location :
contig_47:280272- 294714
Transcript NameFunction/comments
g7875.t1conserved hypothetical protein
g7876.t1hypothetical protein PHYSODRAFT_298682
g7877.t1hypothetical protein PHYSODRAFT_543923
g7878.t1hypothetical protein PHYSODRAFT_496973
g7879.t1hypothetical protein

Sequence
14442 bases(100 bases per row)
TTAAAATAAGCACCGGAATGGCAGCCTTGCGTGCAAAATTGCTGATCCGCCTGCGATGCTGCAGACCACCACTATATTTACCATGGACGCCAGCGGCACC
TCCCACCTGTGAGGCGATTTTTAGAGATGGAAACCTCCAGAACTGCGGTCTATCTCCGGACATGGTTCTTGTCCGACAACTTGGCTTGCAGAAGTAGTAG
ATGGCTCGTCGGTTGATGTCCGTTTCCTGAGCTCATTCTTGATTCGGCTTGAGCGAGTGCGCGAGGAAGAACAGACTGAGACCAAGCGACTGGCAGCATG
CGCTATCGGGAGGGACTCGCATTGCTCCTGAGCACGACGATGGGGTGGAGCCCGGTGCTTGGAGCAGCCACGTGGCCGTCCACCTGCTCGGATTCAGCGA
TGTCAGTGTGGCAAGCCACGTGTCCCGCGCGCACGGCGAACAACACCAACTACGTGTCGCCAACCGGCATGACTTCCGCTGAGATCAACGCCGACGAGGC
GAATGCCCTTGTAGCGTACAAGACGGCACGTCAGAGTGCTCTCAAGTTGAGCGCTGTTGCAGGAAATTCTGCAATGTCGGGAATGCGCCAGAAGAGCGAG
AGCTGGTACAAGAAATCGTTGGCGAGCTTTACCACCTACATCTGCGTCCAGTCCTCGACCGACGCAGAGCTGGAGCGCTGCGTGGACCCCTCAAGCAGTG
ATGCTATGCGCGACATCAATGGCAAATGCGTTGTCATGCTAGACGCTGACTCCTGCAACAGCAAGGACAAGTGCGAGCGCAGGAGCAATTGCAAGTGGGA
CGACGTCGTTCCTAATGGAAAGGAAGCCCGCCGTCAGATCTTCACGGACGCTGATGTTACTGCTGCGACCAAGTGGATGTCAACGGGGTACCCTAGTTCC
TTGGCCCCTTTTGTGGCTCCTGGCACCGTCATGGGTGTGCTTACAGCGTTGAGCTGCATTGGCTTCGTAGTGCTCCGATGCGTATTCAACCGCTGTGGTG
GTCGTGAGCCCAACGAGAAAGGCTACTCGCGCTGTGACGTCCTCGTCCCGACGCTCACTTTCTTGATCTGTTCGCTGGCAGTCTTCATCTGCATGGTCAT
CACAGCAGCACTCAATACAAGCATCTCGGATGGCGTTGAAGATGTTCTGTACTCGCTAAAGGCTACCTTAGAGAACGCCAACATCTTTGTGGCCAATTTG
CTGACGCCCCTGAACGACGCCACCGCTGAACTTACTGTAGCGTCGAAGGCGGTGAACGCTCAGCTGAAGAACTCGGACTGGATCGTGAATGACGGCGCCA
CGCTCAGGCAGATGATTGCGGATTTCGGTAGCATCTATTACAACCACGGCACATTCCCGACCCTGACCTGCGATCCTGCGACGAGCGAGACATTCTGCAT
GGCATGCCCCGACCGAGTTTGCGGCTCCCCCGTCACGTTCTTCGTCAACAACACCGCAGCCGCAATCACGGCAAGCAGCGACATTGTAGGAGACGCGGTG
GGCTTGCTTCTAAGCTCACTTGTGAACGGAAGCGCTGCACTCGACACGACTCTGCGTACGGCGAAACGGGATATTGCGGTTTTGGGCGCAGCTACAAACA
GCTCCATGGATGTCGTGGGCGTGCTTACCAGTACTTTCAACGACCTATCATTCTCGCGCAGCGCACTCGTGGTGTGCGTGTTCCTGTTCGGCATGATCTC
GTCGATCCTGGGGATCATTGCCATCGTAAAGAACGCCTGCACTGCTAAGACGACCCAATGGGTGCATCTGCTTCACGTAAGCTGGGCGCTGGGTGTGCTT
GTGTGCGTGTTAAGCTTTGTGCTTTCGGCATCCCTCCTTGCAGTCGGAGCTGTGTGGTATGACTCGTGCGAGTACATGAAGCTACTCCACGAGGACATGT
CCCGTACGCATCGACGCAGCTATCTGCGATGGCGAATGCTTGCTTCAACGGCAGTAATGTGCTCACACCGCTTGGTCTCGATGCTCCTCTGACCTTCTCC
TGCAATGTGGAAGACGAGTATAAGGTCGTGAAGACAGCGGACACCACGAGCGTCGGAACAGTCATCTCGAAGTACGGCGAGATCGTGTCCAACTTCGACC
TCACCGATTTTAACTTCAACTCGACGCGCTCGAGGAACTTCGTGTCCAAGCTTGCCACTGCAGCGAGGCCGCGAAAAAGAAGCCGGCCGTGAAATTCACA
CAGGAAAACATCCTGACTCCCTGGTGGCATACAACGAGCTGGCCACATCGTACGGCTGTGTCAACAAGACCACGGAGGAGCTCCCTGTGTGCTACATGAC
GGGTCTGTGCGAGTCCGACACGTCGGCCAAGACGACAACGCAAGCCGCTTGCCAGCTTGCATTCTACGAGGCGTACGAGTACATGTTGGCCTTCGACAAG
GCGAGCACGATGCTGGACGAGATGCGCGAGACTCTTCTGGGACACGGGCAAAACCTTCCCAGACCAGTGGAATTACTCCATGTCAATCTCCGAGTTCGCC
ACTACGTACTTCACCAAGATTACTGCTCTGAAGACCGGCCCGCTGCTGACGATGCTGGGGGAGAAGGGAACGGTGCGCAGCCTCATGACGTCCGTGGAGC
GGGCACGCTGCTCGGGCGACTGCGCGTGGGCCAACCTGTCCTTCGACGCCATCAACGAGTCGCTCTGTCAGAACGTGCTGGGCACGACACTGGCCATCTC
GTTGTGCGCGCTGTTCCTGAGTCTGTTCCTGCTGCCGCTCATCCTCTCAGCAATCCTCCTGCAGAAGCGTCTGCGCGGCGTGGCCAAGGGCACGTACGAC
CAGCTGGAGTTGCGTTTGCAGGAGCTGGAGCGCCGCGCCAAGCAGCAGAAGCAGGAGTCCGAGGGTCTGTCACCCAACGGCGAAAGCTCCAAGCCCACGA
GCGGCCTCAGTGCGCTCGGCGGGCTCTTCAAGGGCAAGAAGGTGCAGCAGCCGACGGGCTCTCCGTAACGCGGTTTATTAGCCTCCTTTTCTATAAGCCA
GCGCCGTGCTTGCTCAACGGAAGGTGAGCACACCAGCGCAGGACCTCGACTATTAAAATACAAGTAGCATTTGCATAAGTCAGCAGTTTGCCATTTGCGA
AAAAGTATCTTGCCTCTTCAACTTGCTCTGGACGCTGTTTCAGCCAATCAAAATCGATGCAGTTCTATGTTGAACCGCTGCATTTCTACCAACCAGTGGC
CAGTTCCAGTTCAGTATCACATTTCCACAGGTCATCGATGGCAGCTCGCGACGTAGTGGTGCTGGGTGGGGGCATCTCGGGCCTGACGCTGGCCTACTTC
CTGCGCCAGGCGCTGCCCAAGGCCGCAGCCGATGCCACGCGTATCCGCGTGCTGGACGCCGGCCCCGTCCCTGGCGGGTGGGTACACACGGCCAAGCGCG
ACGGGTTCCTGTTCGAGGAAGGTCCAAGAGGTTTCCGACCCTCGCGCAATGGCGCCGAGATGCTGAGATTGGTGGAACAGCTGCAGCTGCAGAGTCGTAT
GCAGGCCGTGGACCCGGCGGCACACGCGCGATTCATCCTGCGCCACGGGAAGGTGGAGAAGGTGCCTGGATCGCTACTGGAGGCGCTCCGGTGGCCGCTG
TCGCTGCCTGTGGCGCGCGCGGCGCTGCACGAGCTGTTCGTTAAACCAGGGACAGCAGAGGACGAGTCTGTGTACCAGTTTATGGCCAGGAGGTTCAGTC
CCTTAGTGGCTGAACGGCTGCTGGACCCCATGGCGTCGGGAATCTTCGGTGGAGACATCAGGAAGCTCTCGATGCGCTCGTGCTTCGCCATGCTTGTGGA
TATGGAGAGGAAGCACGGGTCGGTGGTCAAGGGGATGCTGTTTGGTGGCACTGGCGACGACACGCTGCTGGATGGCACCAACAAGTCGGACTTTGTCAAG
AAGCATGAGAAATCGGTCAGTGTGAGCTTCACGGACGGCATGAGTACACTGATGGATGCACTGGCAGACAGTATTGAGAACGACCCGATGGCGGAGCTGC
AGCTGAACACGAAGGTGACGAGACTAGCGGTCCACGGTCTCGACAACGCATCGTCAAAGGCCCCCAGCTTCGTGGTGGAGAGCAAGGATCCCACGTCCGG
GGAGTATCGGGAGCCGATTAAGGCCTCGCACGTGTTTTCGACCATCCCGGCATGCTATTTAGCCCCGGCTGTGAAGGACACGGCGCCTGGATTGGCAGAA
GCGTTGAGCGAGATCAAGTTTGTAGACATGGGCATGGTGCACGTCGGATACAACGACAAGGTGCTGTCTACCGAGGGCTTTGGGTATCTGATCCCAACTG
CAGAGCGTGAAAAAATACTTGGTGTTGTGTTCGACTCCAACACTTTCCCTGTGCAGAACGCTGAAGGCAAGACGCAGACGCGACTGAGTGTCATGAGCGG
TGGCGCGCACTTCCGTGAAGTGGCGTCGCTGCCGGAAGGAGAACTGGAGCGCAATGCCCTGGATGCCCTCAATAGACATCTCGGTATCACGTGTGAGCCT
GACTACGTGCGTGCTATGACGATTAAGAACGGAATCCCGCAGTACCACGTGGGCTTTGCTCAGACGTTGCAGCGTATTGAGAAGCAGGCGGCGCGCAGCG
CACCGGGTCTGTTTCTGGGTGGCAACAGCTTCTACGGCATTGGTCTCGCTGACTGCGTGACCCACTCCAAGCAGCTCGCGCTCAAGTTTGCCAAGATCGC
GTCGTCTTGAGAGAATAGAGCTACGAGGCAGTTGGTGCATGTGCACATTTTGGTGCTGAAGAGTGCGTGCGTAGTGTGCGATGGTGCGTGAAGTATCTTC
CACACTGCAGTGAAAATGGGCAAATTGCTACCGTTCTCTTTCGTGCCGGTTTTCGAGTTCTTCGTATTTATTTGGGCGGGCGTGTTGTGCAGAAACGGCT
TTTCGGGAGCGACTTCTTCAGCTCGTCGATCTTTCGGAGCTGTTGCGTGCTGCAGCCAATATGTCGCGGACTGCGCCATCTCGAGCGCTTGATCCTGTCT
ACGGTAGGCTTGGCGTCTTCGTTGTGGACATCTCGTGGGTCGCCTTACAAACTGTTCACTGTCCGCTGCAGATACGGTGTACACGGTCTCCAATTCAGGC
GGCTCATTCCGCAAGGGTGTCTACCGAGCATCTTCGAAGCCTGCTAGCACTGTGAGCTCCATCGGTAACCAGAACCCGGCGGAGGGTAATGAACTCGTAA
GCGGCAGCCAGCGGGTCAAGTTCCATCGGAGACCAGTGCTGCCGCACCTGCAAACGGAGCCACCGGAAGTTTTACTTGCTCCGGTATATGCCGCCTCGGC
ACCGCCAGTCAAGCATCGAGATACGAAATTGTCAACACCCTCCCATGTTGCTGCCGATGTAGTTAATGGAAATACTCGGTCAGTGGGTATCCAGACTGTT
TATCGCGAGTCGGAGGCGCAGACAGACCCGTACACACCAGACTACACCGTTCAAAAGACAGCTACTGGTTTAGCACCCGAGATCGCCACGCTTGCGGGGC
TAAGCCATGCACGTGGTCAACTACCAGTTGGGCAGGCGGAGCTGGAACTTATGGAGCGCAACCGCAAGAAGAGAGCTTTCGAGGCGTCGCTTCCCCCCAT
GACCGACGAAGCGAGCTTTCTGTTGCGCAAGGCAATGCTGGAAGCACAAGAAACCGTGAATGGGCATTCCGCGAGGCGGAGATCGATGCTTTCCACGATC
AGCGTGTTGTACTACTTGAGCAAGCACTTGCGGAGCGCGAGAAAGAGACCGCATTTCTTTCGGAGCAACGGCTTGAAGCGCTTCGTCAGCGGCTGCTACA
TGAAAAAAAAATGCGCTTGAAAGTATTCAACAAGAACGCGTGACAGCTCTGCGAAAGTTGACGAAGAAACGAGCTCAGAGACAGCAAGAGCGCGGGTTTG
GCGCATCACGTCCGGAGAGAGGCCGCGACATCATTGCCGAGTACGCGAACTTCGGCTCGCAAGTATATGCCCCTGTCACCCGAGATGGGAAGGCTGGCAA
AATCGAGGTTCGTGAATTGGGCATCGGGAAGGCGCAGTTTTTGCAGCTTGATGCTTTACGCGAGCTTGAGAGTGCTTTACCTGCGCGGATGTTACTTCCT
GCTGCTGGCAAGTACAAACCCCGTGAGAAGAGTGGCCACACTGCCAAGGAAAGGAAGCAAGCAGCTATAGAAGCCCACCTCCTGAAGATGGAATCGATCA
TCAAGAAAAACAAGGAACAGAAGGAAAGTACCAGTGCGGGTGATACTACCCCTGGAGCTCATAACAATGCTCGCCTGAATGCTGCTAGCCCGCTTTCACG
ACGAGCGAGTCAGAGACAACCACTAGTACGTCCACCCACACCTGACTACGCAGCGGGTCATACGGCCGATTCGCAAGAGAACGAAGTGGAGGATGCAGTA
CGCTTACTGCAGAAATTGCTGCGCGGCCGTGCTGTCCAAAATATGATGTTCGAGGGTAAGGAGAGGCGTGCCGAGCTCATTGCAGAGCTGCGTGCAGCCG
ACGAGCAACTAGCTCTGCAGCACCGCCATGAATTCGCACTCGCGCAAGGTTCTGGCAACGAGGCAATCGACCGTGTTGCAGACGCAGCAAAAACCCGCGT
GGAGGGCGAAGTGGTTTCTGAAATGCTCGACTTCTTGTCGAAAGAGCTCTATCGATCTCGTGAGGTGGCTAAAATGCGTGCTTTCGTGACCAAGGCAGCT
GAACAGCGTCACGTGCGCGAGGTAGAGGAAGGCGGGCGACGACAAGCTGAAGACCTCTTACGTGAACGGGAAGATGAAGTATTCCGACGGGTTATGCAGG
TGCATCAAGAAACATCCGCGACTTCGTTGACGACATGCTGGAGGATGTAGCTCTGGAACAATCTCATTCCCAAGCGCTGCAGGAGCTACACGTACGCAGC
GCTGGTGTCGATGGACTGGTGCTTCAGCTGGAGAGTGAACTGGACAGCGATGAAAATATTGTGCGTGAGCTAGTGGCAAGCTTCTTGCTACCACAAGTCC
ACAGACAGCACGTACGCCGTCAAGTTACTCAGGAACAGAGAAAATATGTGACGGCAGCCCACGCTTTACTAACAGAGATGGTTACCGGAATGAGTCAACC
GAAACCCAATTCCAGTAGCAACGAGGCAACAGAAGACATTCTTTGACACATGAAGGAATATAAGGCTTATTGAGGCGCTAGCCAACATGGTGACTTATCC
TTGATGCACAAGCAATAATGTCTTACTCGTTGCGTACTCGGATTTCACAGCTAACGGGTCAATTCACGTGATAGCTACTTGCCGCTCGCACCCCCGGCAG
AAATACCGGTGGTGCCACTTCCTGCAGACTTGAGGAATGCATCGAGATGCTGTCCTTGATACTTGAGAAAGTCTAGCTCCTCTTTGAACTTCTTCTCCTG
CAAAGCTTTGCGCTCGGCCGCTCGTTTCTCAATAACCTCGAGTTTGTTGGTTAGCTCCGCCACTTTGCTTTCGCTCTCGTCCTTGTCACGCTGAAGGCTG
GCGATCTGCTCTGCCAGGTCACCCATGCCGTCTTCGGCCTGCAATTGTTTTCGGACGCCAAAGGTCAAACTCGAGTCGTACAGTGTCTTGTAGGCATCCG
TAGTGAGTCGAAGCTCATCACGAACGCGTAGAAGCAACAGTCCTCGCTCGGGGCAGTTGAGTGTCACCTCACGAATAAGCTCATCGAAAGCTTGCGAGTA
CAGATCCTCCCGGACGGGACAAATACCGCTTTCACGGGCTTGTCGCTGTAGTAGCTTGGCATCAAGTGCCTCCTGCAATTTCAGCACATCGAAGCGAGTC
GAGGGCACGCTGGACGCGTACCGAAGCCAGAAACCTGAATTCTCCTCGGACCACATCCTGAAAACAGCAGAAGCGATGGTTTAGCACATGTCATTGCAAG
TGATCGGGTGGTGATAACGGTGACGCACTGGGGCGGTAAGACAGCATTTAGGATATCCTCGACCTTTGCAACACCATCGGAGCTTTTGCCATTAACTGCC
CCACTCGACTCCGCGGCTGCTGCCACTACAGTTGCTGCGGTGATGGAATTCGAGGAACCTGCGTTGGCAGCACCCGGCGTCCTCTTCGGTGGGTCTAGCG
TTTCGCCCGTGAAGATCGGCTCGCCATATTGCACGAGGGATTCTGGAGGTGTCGGTGTTGACATCTTGCTCGTACAAATGCTTGGTGTTTCTCCAATTCA
CGTCTGCTAGCAACCGTCGCGTCCGTTCACGAACTCAACTTATCAAGACTCTGCAAACGCACCCCATCGTTATTTGCTTTTCTGCCTACAACTTCCTAGT
GACGCTGGTTAGATTTCGCAGCTACAAGCTCCTGCTTCTCCTGACGCTTGCGCTCCGAGAGTTCTTTGGTTAGCTGCTCTGGGCTCTTGTAATTGTCTTT
GGCACCAACTTTGCGCAGCCACTTGCTACTGTTGGTCTGTCGTGCTGCCTCCAACGCTGCAAACTTCATCGAACCAACACGAATGAATCAGTAAAGTTCA
AGACAGGATGGCATCATTCTCACGCACGTGCTCTTTGCGAAGAGTCTTGGTGAGCTCGATCGACTGGTTCCAAGCCTTGACGTCACACAGGTCTGGGTGA
TTGGGTAGCTCCTCTGTGCACTTAGCAATACCCTGCAAATCAGAGAGCAGGCACGTCAATAATCCTGCGGACACTTAAGACAGTTCCCCAACTGATAGCC
ATACTTTCATCACGCGCTCGTCGCCGAAGGCTTCTCCTATGTACTCGTCCTTCAGAGCCACCTCCAGGATGCCAGTGTTGAAGCGGTTTGATTTAGGCTT
CAGTGTTGGATTCTTCTGGGGTAACTTTTCGGCACGGAAGTTGTACGCGAACATGTGGGCACGATTTCTCTACAAACGCCACAGTAAAGTGTAGCTTCAG
GAAGGAGAGGGCGATCCACTCATTTCTCAAAACGAAGCGTACCTCAGCATTAACATTAGTTCTCTTGTAACACTTCCCAGTCATCTGCATGTTGTCCCAG
TTCGAAGTAGAAGTCTCCCATTGTGGGGTCTCCGCCGAAAGAATGCGCGAGCGAAGCATTTCAACGACCTCCAACTTTGCCGCCGCTTTGTCGGGCGCGG
TATCAACTGGGCAGAATACCCGTTCTTCAAAAGAGTAGTTGATGGGTGCATCCTTTCCACCAATACGCTTTTTCGCATGCATGACAGTAGTGCTTGATGG
AGGACTGCCAGTCGCGAGTGATGAGGTGCGCGTGGTGCTTGCGGCAGATTTCATTGCCTTCTTCTTCTTCGACCACTGAGAGTCCCCGCTTTGGTCTCTT
TGATGCACACGCCCAAACAAACATCGTCGAGAATATAGACCACGCATCATAAGAGACAATGCAGGGATCTATTACCGTCGACAAGTGTGAATCGATCCGC
TATTAATTGATCTGGTCAGTGCATTGAGAACACGTGAGAGCTTGTCTTACCTGCAGATACTCTCCACATCTCAAGCCGACTCGGTTGCAGCAGCTGAAGC
GGTTTGAACTTGCTGGGCCTGCCGGATACTATTGCGCTCGGCTTGAAGGTGGCGACACAAACTCTCGAGCTTCTTAAGCTTCTCCTGCAACTTCAGCGTT
TCCTCTCCAGTTGTCACCTTCTCCTGGATAGAGGCAATCGCGCCGCTGTCATACGCAGCACACTTTTTCCGAAGAGCAAGGTTCTCCTTCTCCAGCTTCT
TGGTCGTTTTTGCCATTTTGTCCATTTCCTCACGGAATGTCGTGAACATCTGGTTACTTTTTGTCAGTGTCTCCTGCACGACGTCGAACTTTTCAGAGTA
GGAGTTCAGCTGCGCCTGTAGCTGAACCTCGCGATCGGAAAACTCCTTGGCCTTGTCGAGGGTAATCTTAACCTTTTCTGCCTCGCGTGAAGTCAGCTCT
ACCTGGTGCTGCAGCTTTGTTTCCGCAAGCTGCACTGTCAGATCCTTAGCCTCGAGCTGCCGCTGGAAGTGCTCTTCTCGAGCAGTATACTGTTCAAGGA
ACGTCTTCAGTTTCTGCTGGAGGCTACAAATATCATGCACATCCAGGGTAGGCAAACGTCAGTTAGAGTGTTGCGTCACTGGTTGGATAAGGAACTTGGT
CACATACTTTTCATTTTCCTTCAATGAGGCCACGTAGTCCTTGCTCTGCTGATCCATTTTCAGGCTCACTTCTTCGATTGTCTTCTGAAACTGAGCCGAC
AACTCACGTCTGCAATCCCGACATGGACCAAACACGCAACGGTTAAAAAATAATTCAATAAGAAGTCCCCAGTCACATCGCACCCACCTCTTCTGGTCCT
CTTCATCGGCAATACGACGGCTTTCACTCTGGATACAACAAATGATGGTGAGCTCGTTATAACGCTGGAACAAGAGCTAGAAATCTCCTCACCACAATGA
GCTTGTTCTGCTTCTGCAGCTCCCTGCAGAGCTGCTCCAGCTTGGTCTTGGACGTATTCGTCTTCAACAGCTCCGTGCTCACTACACAACATCCCGAGAC
TCATCAGCACAGGGAGGTACTTCACGATCTCTTGCAGCATTCACCTGCGCTCTTGCGTTGCTTCAGCAGAATGCACTTGGCATTCAGCTCGCCAATCTTT
TTCTGCAGCAGACCCAGTTGTTCACCCTGCAAATTCTACACACGTCAGTCTCCACCTCTTCCGCCCCAACAACTGCCTAAACACGCACCGCCTGGTTGAG
ACTGTTGACAAGCTCCACCACCTTCTGCTCCGCCGGCATTTCCTTGTCCTCCTTCACAGCCTCCGCCTTCTCCTTGAGCTGCGTCAGCAGCGTCTCGTCC
TGGTAAATTCCTGTCACAAACCGTACTTTTCAGTATTTTATCTCTCGAAACTCGCGCTTTTTCGTCGCACCCGTGAGCTCGATGGGCGCCTCGAGGTTCT
CGTCGCCGCCCACTTCGATCTCCGCGATTTTTCCGGCCAGCAGCTCCCGCAGCGCGTCCTCGCGATTGGCTTTGGTGTTGCGCTTGCTGTGCGCGTGGTG
GCGCCCGGGAGACGCTGCGGACGGTGAGCGCTTTAACTCTCCGCCCTTGCTGGACGGTCGCTTGCTCTTGTGCTTGAGGCTTTTGGTCTCGCGCCCCAGC
TGCTTGAGCTCCAGACTCGGGTTCTCCATCTCGTGCGTCTGCTCGTCCGACATCTTTTTCGCGTTTGGGTGGCGCGCTGAGGTTTTGTCTAGTTCGATCT
AGCGTACACTATATGTACACAAAATTACCTATACAAAACGCGAGTGGGGGTTTGAAGGATTATCATGTTGATGAAGTCAACCGCACTACGACCATCTTGA
GGATATCGAGTACCGCAGCAGCGTTTCCCGCCAGTGCAGACACTTCGACATATATCACGTTGTGCTCACTGCACCACGTGCGAGCTGCTGCTTGCTCCCT
TTGGTCCAATTGATTAACGCAGTCGCTCTTGTTGCCGACCATCAACACGGGCAGTGCCTGCGTAGATTGCGTCTCGATGGCTTCGCCCGCCGCAATCTCT
CGATGAGCGACGTCGAGGTACTTCGGCAACGCGCGCCACGAAGCTGGCGTCTGCAAACTAAAAACCAGCACGATCGCTCGAACGCTGCGAAAATAGTGCG
CGAAGATGTTCGGCCCCGCGAAGCTCTGCGGCGGCACGTCCCACAGCTGACGAACTCTCCGTTAACTCAAGGCCAGATCATCCCAAGCATCAAACAAGGT
GACGCACTTCGAAAACTACCGGTTCGTGTCCCTCGAATCGAAGCAGCTTGGCACCTACGTTGGCTACACGGTGCAATGCCGTAATGTGAATGAGTTCACG
CAACAGCCATATGACTCGCAGCCTCGCTTGCTCACCCGTGGTGGACGGCGTGTATTCCCCATCGAGCTGGGTCCCTATCAAACGCCTGAACAGCGTCGTC
TTGCCCACTGCCGCCTCGCCCAGCACGACCACCTTCAGCTTGTCCAAGGTCAGTGGATCCGAGCCTTTATCTTGCACTGCGGACGTGTGCCTTCGCCTGC
TGCTGGACGCTAAGACCAGCACATCATTAGTCGCTGGCAGCTTGAAGTCGCCCGCTCGCCTTCGGACAGCGCTATACATGCATTACGCCGCCCACGGTAG
CCAAGGGCCCTTGCCTTACCTCGGGCGCCCATGCGCTGCGTCGTTTGCCAACCGAACTGCGGTCGCCGTCGGACAAGTCCCATACCGCTACTGTATAAAG
GTCAAACTCCTGGTATAATCTATACCTCTATACAAGTAAAACGTATATCCTTGCATAACCGATTGCGATGAAAGTAAATTCAATATCGAAATTCGACCTT
GAGAAGTAGTTTCTTCTTCACTACGATGCTACTGACGTATGGTCCACCATGCCGTAATCGAGATGTATCACAGTACGTCCGCTTGGTCCGCCGTCGGATA
AGGCAAATGGCTGCGGATGTGCTTCGGTCCAGAGACCCTGGCACGCTGCACTCACTCTACGATTCTCTTGTGCGCGCGCAGGCGACCGACGCAATCTCTC
TTCAACGCTAGCAATGGACTCCGTGGACGAGTTCAAGCTGTTCGCAGCGCTCTTCATCTGGGCGCTGGGACTGCTGGGCGGCATCGCGCCGCTGCTGAGC
AGCCAGCGCGTCAGCAAGCGCGCCAGCAGCGTGCTCAACATGGTGGCGGCCGGCATCTTCCTCGCCAGCTCGTGCATGCACTTGCTGCCGGACGCGCAGA
ACAACGAGATGGGGATGCGAGCACACAGCCGAGGTCTTCCTCGCCGTCCGGACGCACTACGACGGCGGCAACAAGCGTTGCTTCAAGTGGGCCAACTTCT
TTTACGGCTGCGGCTTCCTCATGGTGCTGCTCATCGAGGTGCTGGCGCACACGCTGCAGCGCCACTACGGCAAAGTGCACGGCCACGGCCATGCGCACGG
CACCGATCAAGAGCGTGACGCGCTGCTAGCCATCGAGGTCACCCGTGCTGCCGAGCTGGACAACCTGGCCACTGCCAACGAACACTCGCACGGACCCGCT
CACGGACACTCGCACGGGCAACTGGAGACGGGAGACTATGGCACTCAAGCAGACGAACTCGCTGTCCAAGGCGAAGACGGAAAGGAGGCGCCGCACTCGC
ACATTCACGGCATCGTGAAAGGCAACCCTATTTTGGCACTCGTGGTGTTCATCGCGCTGTCTTTCCACTCAGTCATGGAAGGCATGGGCATGGGCGCCTC
AAGCACGGCTGCGTGGGATATCCTCGTCGCAATCTTAGCTCACAAGTCGCTGGCCGCGTTCGCGCTGGCACTCGAGTTCGTGCACCACAACGTCTCACAG
AAGCAGCTTCTCTCGTCCGTGGCCATCTTCTCGCTCATGACGCCTACGGGCATCCTGTTCGGTCGGTTGCTGGTGGATACAAACCACGCCACACCTGCTG
CTGGTGTATGTGCCGCGTTCGCTGGTGGCACCTTCCTCTTCGTCGCCATCATGGAGATCATCCCGCAGGAACTGCAGGACCCACGATACCAGATCGAGAA
GTGCTCTGCTCTGCTCGCCGGCTACGGCGCCATGGGCGTGCTCTCCCTCTGGACGTAAAAACACTTTTGACTCATGTACAAGTATTCTCGAAGATAAACA
AGAGCGTCGAACGTCAGTAAGGGCATTCAAGAGCCCGCTTCGCCTAGTGCGAACGTCAATTCAGAATTCACTGATAAACGTTAGTAAAAAAGTTAATGAG
AGAAAAAAACTTACTCAAGTAGCTAAACCACGCCCAAAAACGTCGAGGGCTTCTCTTCTCTCTCAATCTGGTAGCATGTGGGTTGAACGAACCGCTGCTA
CTCCACACCACCATCGGCTGCTACAGGCTCCAATGCAGCCAGCGGATACAGCCATCCAGCAATCCTTGAGTTCGCATCCGGCGTTGCCTCTGCTTATCTG
CCGTACTTCTGGAACTCCCACTCGCGGTTGTCCAGCGGGCACACCTGGCGGGTCTTGAGCCACCTCGAAATACAGTGGAAGTGGAAGGCGTGATCTGCAA
CAATAAAAATCACAATACGCCATTAGCAAATAATCCTCTCAATCCCAACCCCAGGCCTCCGACGTACTGCAGACACCCCAGGCCACCGTGCACTCCTCGC
TGGTGGCCGACGCCTGGTTGGCCTGGCACTCGATGCACAGGTCCATGATGTGGTTACGGCAGATGGCGCAGTTGTCCACCACGATGTCTAGAAAATTAAA
ACAACAATTAATTATCAAAGCCCAGTAAAGATCTCGGCGTGTTTGCGGCGGACGCACCCCAGGACCACAGCGCCACGGCGTTCCACTTCTTGATCTCGAA
GCGCTTCTCCTCGCTTGCGTTTGCCGCCGGCGCCACGTCCGCCGTCACCTCGCTCTTCATCTCCTCATCCATCGTGCTGCACTTGCTCGAGCTCTCGACG
CCGGGTTGACCGATAGATAGTGAATGGTTTCTTCCTCTCGAA