Description :
From Genome Similarity Track
Location :
Scaffold_24:280260- 310523
Transcript NameFunction/comments
Physo_133101hypothetical protein
Physo_133102hypothetical protein
Physo_133103hypothetical protein

Sequence
30263 bases(100 bases per row)
TCTCACTTCTTCACCAAAATTCCGGTTCGTTTTCGATGCGACGACCAGCTTCACGAGGTGCCGTGTCATTCGAAGTGCGGGGTTTCGCAAGCACGCTGTC
AGGTCTGACACCGCATCGGGCCACCAGATCGCCATGTCCTGAATGGGCCACGCCAGTATGAGCCGAGACCACCACGTCACAGTTTGTCGTATGGAGTCTT
TCTAGTAGCGGGCATACGCTGGCCAAGACACTGAGATCTACAACAGGTTGGTTGTCATCCTTACTCGCCACTTCAGTGGACAATCTGCGAATGCCACCGA
AAGCCAACTTCAGAAGATCCATCGTCACCCCAAAATCTTGAAAAACCAATACCAACTCGTCACAAAGGCGCTTCTCGTTTGGGCGGAGTTTCGTCACATC
AGGCGTGAACTGCGTAGAATCACCGAGTCTTGTCTTGCAAGCCCCGTAGCCAGGAACAACGAGATCCACAAAGTCGCTGTTAGTGACATCGCAAGAAGCT
CGGCATCGGAAATTGCAGGATGCAACCAGAGCGTTGCTGTCATCAGACGGAGATTCACGAGACCACAGCTGTGTGCCTTCGTCAACATCCACGGACCCGT
ATACGCGGCCATGGCTTTGAGTCGCACTCATTGCTGTTAAAGGGAAGCCAGTAGCCAACACTGCCGCAATAGCTGACATGTCCTCATTGGTCACTGTCAT
TGCTCGAATCATCAGTTTATCGACAACGCTTTCGGGAGCTTTGGTGCTGGTAGCTCTGCAGTGAGCGCATACATTAACCACGACCACTCGTCGGGCTTCA
TCACTGGGAGGCGTAAGCTTTGCAGTCGTGTCCTTGGGTCCACCAGAGCAACTGCCGAGCAAACGGCCGCATAAATAAAAGCGGGTACCGAGTTGTACGG
TAAATGCAACATTTTGCATTCCGCTCGAGCTGTAATGCGGGCTGAATCCTCAGACATTGTTGATGTGCAGAGTGACCGACCGCAGATCAACGCGCCCAGG
AAGAAGCCTGCATTGACCAACACTCCAGGAGACTTATTCTGGTTACAACACTCCAGCTTAAGGGTTAGATTCGAGGCTGCAGTCCAAGCCAATCCTGTTG
TCACCTTCAGGATATCCGACGCCTCAGCAAAACTATGTATCTTTGCGTCTACGTCGTGTCTTGAACGCGTTAATAGAGTATCCGTTGCCGGAGGTTGCCT
GGGCATCCCATCGCTATTGTGATAGAGTGCGAGTTGGACATTAACGGGAGCTTTCGCCTCCAAAACTCGCCGAAGTTGAGTGGACGCAGCATTCAACTCA
CCAATCGTATGGTCGAATGTCTGCGTACCGCTTAATTTATAAGACAGGAAGTTGCAGCTCCACTCCATCGAAAAATAAATGGGCCCGTATGCTTCCATCA
GCTTTTCATACCCCATCGCCACTAGTTTATGAGCTGCAGCTCGAAAGTCAGGCGAGTATTCCCACGGGTCACCCAGACATCCGAGCAAATCCCCCCAGGT
GAGTGAAGTTTCGACTGCGGCGGGATCCGATGCTGGCAGAGCGCCGACGAACCAGAGATTCCAAGTTACGGTGCAGAAGTCACTACACTGAAATTTACTT
GAACCCATCGCTAGCTCGGCAAATGCGTCATTGTCCACAAACAAAAGCAGCGTGAACAGCTCAATTGCCTCTCGTAGCCGACGCGATCGTGTTTCATGTC
GGCGACTACCCTCATCTACGGGGACCTCGAGATAAACTCTGTGAAGTGCCCAGTCGGTATCATATCGGACTTGGCAAGAAAGCTCCACGCGTACCAATGC
GTTGCGATTTTTCTGGAGCATGCTTTCATCCAAAACAGCACGCCAAGGCTCCAGGAATTCCCAATTCGATGTCATCTGCCCCCCACAAAAACCAAAGTGC
GAGTTTCCCCATTGTCGTCGCGCGCTGCCATGAGTTATATCATTTCATATTTTGAAATGATACCGAGGTATGCATCTACCTTGTTGCCCGTACTATCGAG
TTTCGCGTAGTCGTATTAATACAGTGTAGAGCAATATCTTCAGCAGGGAAGGGCACGGCCATTCATAGCGACATACATGTAACTAGTTGACAACTAGTCT
AGTTGTGGTTCAAATGGAAACTAGCTACTTTGGACTCGAAACCATCTAGCCCATACACTGGCATTCAACCGATCGCTGCGTCGGTGTTGATGCGAATACA
AAGATTGAGCTCAGAATGTACGCGTCCAGGCAGTGAATCGGCTTCGTGCTCCAAGTCGCGGCCGTGACGACACTGATCACGGCTGCCTTCGAACTCGTAG
TGAGTTTTTCCTTGACTACGGGCAGGAATTGACCATTGTGAGCCATCACCTCGCGCACTTCTTCCTCTGCAAACTCTTCATTCTTACGCGGGGTCACCTT
GAGTTGAACGAGCTCCCGAGCCATTCGTAACTTTGGGTCCCTCAAACACCCCACAAGATCAGCCAGCGTGCAGGAACATTCGTCTAACTTGATCGTCTTC
ACAGACCAAAGGCGCAGAGCTGCTTCATGTTCAGACACCACCACCGTAGCATATCTGAGACAGAGATACAGGAGATTGGGGCAAGCCCTAGCCAGAGCGC
AAAGGTCGACATGACTCGCGGCTGTAGCGTCCTCTGCGTTGAAGTATAGTTTCAGCGAGCAAAGGCCCCTCGTGACCAGCACCAACACATCTATCAACAC
ACCCGGGGTCTCGAACTCAACATAGCGCAGTTCCAGAGTTCCACTCAATCGTTTCTCTCGAAATTTGGACCCCCCCCAGTATCAGCCGTGAATCGGACGC
CTCTGTCATCAAGTTTGGCCTTGCAAGCGCCATATCCGGGGACGACGAGATTGATCCACTCGCTGTCGTTCGGGTCGTGAAGTGCTCGACATCGGCAAGC
ACTAGCCACAACAGTCGAGCTACGACCCCCACCAAATGCTCCACAGAGACGCAGCTCCGTGCCTTCATCAATCTCGACAATACCATACTGCTGGGAGCCA
TTTGGACCAGACTGCAACAGCGGCTGAGGATAATTATCTCGAAGCGCGGCATGCATTGCCAATATGTCAGCTTGTCTCAATGCTCCCTTCCGAATTTTGA
CACAAGGCACACCCACATCTGAAGTCCCACCACAAATCGCGAAAATAAGCCAAGGCCACCGCCCTGAGCCTTCTAAATCTATGCTCAAAGAGTCTAGATG
CGACTCAGCTGACAACGCCGCGACTGCCGAGCAGATTGCAGTAAACGCCCACTTACATGTCCAGCACTGCATTCGTTCGTTTTCCCATTTGCCACTGGAA
TGGGATTGTTCAAGTGTTCGCTGCCGGTTTCAGTCACAAGACGCATCACGTGTCCGCACAGCAGCGAGTTCATCATAAATCCAAGATTCAGCAGGGCTTG
CTGCGAAATCATTAGGGTAGCGTTGAGGTCTAGTGACAAATTTGCAATTGCGGTTCTTGCCAATGCGCTCAATAAGTCAGAGACCCCAGGGTGGCCCCAA
CTTTCTATCGTTGCACTTACGCTCTCACAGCGGGGATTTGCTGGGCTCCATGTACCGTAGCATCTTAGTCCTAGGCGTCGTTCACTCCTAAGGGTCAGTT
GTAAATTGACCAGTAGGACACTGGATGCCTGCCAAAAGTATAGTAAACGGTCGACATATCTGCAGCAGATATGCCCGGCTTAAAAAAGATATATGTCGGC
ATATCGCCTGAAAGCTTCACCAAAAGTGTCTTATTGCTTCTGTCTACGTCCGGTTCCTACTGCCCTGAATCAGGTGGCTACACTATAGAATATGCAGTCA
CTTCGATGTGAACCTGTCAATTTGCCCCGGACACTGAAGCGGCAGCACTGCTGCCGCACTTCTTCTAGATTCCGTCACTTTCGGATTCGTGCGCGTCGAG
CGCAAGCAAGCTCAGCGACGATGGCGAGCGTGGACACGGACGCCTTCCTCGTCGTGACGGACGCCTTCCTCAAGCAGGGGCGGGAGCTGGCCGAGGCGCG
GCGCGAGGTGTACCGCTTGCTGCTGGAAGAGGCGTGGCGGACAGCCATGCGAAGTCGCAACTACCTGACGGCACAGTGCCTCGAGGCACCATGCAACTCG
GCCTGGATGCTTCTCTACCGATTTGGGAGCGATGTCAACTTTATAAACGCGACGAGTCTCACCAGGTACATTTATTGATCGAGTTAAATGATACAAAGCT
GTATGTAGCTAACGTGTGACTGTGTGCTGCAGACCTGCTTTCGAGCAGTTGCTGCGAAGGTTTTCGCGCTTCTACTTCATCCCCAAAGCCAAGTTGCGCG
GCCGCCCGCCCAAGCTACGGTACCACCATCAAGTCCTGGGACTGGTGCTCTCGTTCTACGTCGGCTCGATGGAGCAGAGCTCGCTGTCCATGCTCTTTGG
CTTGCCCCCGAGCACGCTCTCGCGCATCCTGTGTCGTGCAGAGGAGGCGCTGTCCAAGGCGCTCCATGGGTATGCTCCGGCGCGCATTTCGTGGCCATCA
CCAACGCGCCAAGCCGAGCTGGCAAGCTCGTCGAGGCACGCGAGCCCCTCCTCAAGTACACTTTTGGTTTCATCGATGGCAAGAACTTCAAAGTACGTAT
GCAGTTGTATTCATTCGATCCTATCCGTCCTAACCCATATTGTTGGCTATATGCTGCAGGTGCAGCAACCTTCCAACGCAGATCTTCAAAATGCTATGTA
CAATGGATGGCTACATTCTGTTTTCGTTACAGGAACTATCTATTTTGCGACCGACGGCTGCATTATCTGGAGCCGACACAACTGCCCGGGTTCATGGAAT
GACTCGGACACGTCGCTCGGCTTTAGGTTGAAGCTACTCGATCCAGCCTTTTGCCCGGATTCGAGGATGAACGTCGTCTCCGACTCCGCTTTCCCCTGTT
CGACAGCTATGGCGGGGCGCATTCTCACACCCCTCAAGGACGGAGACCTCGAGCGGATCCTGCCGTCGCTGAGGGCATCGGCGCGCACCCTTCACAATGC
CATCACCTCGGTCCGCCAGGCGGCCGAGTCGGGCATGGGAAGCGTGCAGAAGGTCTACTCGAGACTCAACCTGCCACTGCCGTACGACCCCAAGCTCCGA
GGACTTCGCCTGGACAACTTGTTTCGCATGGCCAACTCCAGGGTCCGAACGGTGGGGATCTCGCAGATCCGAACCACGTTTGCTGGCGAGATGGAGGTGC
CGACTCAGGTTGCCTAAGTAGTGAGCGATTCATAGCAAGTAGCGTGGCAACAATATATTTTGCGTGGCGTAGAATTTCTCGAAGTCCTTGCAAGTACACT
AATGCTGAACAGATGATGTGAAGTTGTTGTAGGACTTGCTGATGATAACGTGGAAGATGGTGCTTATCGCAAGTTAGAGATCGATGCAGTTCAGCAGCGA
GCACGACTTGAATGAAGATGAAGATGCTGTACATGAAAAGTTGTTGATTCAACGGCTTTGAGATAAATGCAACGCTACTACAATATGAATGCGCCATGCT
GCGAGGTGCAGAGCCAACAACTCCTTCCTTCGTCTCCATCTTTGCTAACGCGCTCTTCTTAATGGCATTGATCAGCATGATCAGCTCCTGCGTGCGAGTG
CGCGCATCCTCACGGTCGCGACGAGCTCGGTCCTCTCTTTCGAGTTTTTCTTGACGACGGCGTCCCTGGGCTTCGGCCTTGTCGGCAAGGTAGCGAGCCT
CTTGAGTAGCGACTTCGGCGCGGCGACGCTTGTCCTCTTCAGCGCGGCGTTCTTCGGCCTTGCGTTCGTTCTCCTCACGGAGAAGGAGAATCGTCTCGAG
CAGGCTTCCGCCCGTGTTGTTCGCAGCGGCTTCGAGGCTGGCAAGCCTGGTCTTGAGGGCAGTGGACGTCCTCAAGGCGCGAATCCGCTTCGCTTTTGCA
AAGCTTGCCTCCATGGTCTCCTTGTCTTCTTCGAGCGCACGCTTGGCACCGACGGTGTCACGGAACGCTGTCAGGTCCTGCCCGCCCAAGCGGTTCGAAA
AGTTCACGAGCTTCGGGCACTTCTCTGCTTCTTGACTGCGAGCAGCAGCGAGCGGTGTCTGCTGCGGAGCCGCCGGTGGGCTCGCATTGGCAGCAACGGA
GCTGACAGCCGTTCGACGTGGTTTCGGCGGCCCGCTTGCCGTACGGCGCGTGGTACACGTTGCTGGAGGAGGCGCCGGTCGTGGAGTACGTGCACCGTCA
CCGGACCCACCACTCGTGAGTGGCGCCGCAAGCAGCTCTTCAAACTCGCCCAGACTAGGCGATTCGGATTCGGTGGAGTCGAGCCCGACGGACTCGTCGG
TGCACGTCGACCCTTCAGTGCTGGGCCGGCCGGCCGTCTGCACGCCTTCCCCATCGGCGTCGTCGTCGCCGTAGAAGCTCTCGTCGGGGTCCGCTTCGAA
GCAGAAGTCGGGCTCGATGGGGCGATCTTCGTCGGCCTCGTCATCCATCTCGATGACGTTGGCCTTCTCGTCGATCGCCAGCTTCACCTCCTTGGCCTTC
TTGACGTGCGGCGGCATGTTAGGCGTGCCAGTCGGCTTCCTGGTGCTGTAGAGCACTTTGAATTTGCGGCGGAGGCTTTCAAAGTCTCGCTCAGGGGCAC
CGCGAGGTCTGTTGGCGTTGTACGACGCCGCTAGACGCTCCCACTCGTCTCGTCCGAGCGGAAGCTCGTTCTCGATCAGCAGCAAGAGGCGGCCGACGTC
CGCCGTGGTGTAGTTGGGGTTTCCGGTTTGTCGGACCATCTACATGCACAACAAGTTGAACAACCCCATCAGCAAGCTTGACATCAACGAATCTCGCGTG
GGGCAGCGTACCAGGGCTGGAAGCGCGCGAAATTGAAGCTTGGGGCGGGGCGGGTATGCGTCTTGGAGGAGGGTGCTCGTTGCTTGGCAAAAGCAAAAGT
GAGAGAAACGAGTGCGCCGAGAAGCGGCGGCAACTCGACCAGCACCATGCCGCCACCGCCACCAATTTGAAAAGGATGCTGCTCTTAGCAGCTTCAACCT
GGAGCGCGCGAAAGCTTCGCGCCCAAAGTGCCAAACGCAGCAGCAGGAAGCCGGCTCGAGATCTTTCGAACGAAGCCGTCTTGGCGCCAAATCACATTCA
CAGTGGTCGGAGCATCCCCGTAGTCTGGCAGCACTTCGTCCCCACAATACACTCGATTTTCAAACACCTTCCTGCATTCAGTCGTCCATTCACTCATACA
TGCATGTTGCTTCACTCGATGCTCCGCGCTCCTTAGCAACCTTGCTGTGCTGCTGTCATCTCACGGGTCTTCTCCGTCTTGGATGTTGCGGTGGCGACAG
CCGTCTCGCTCGCAACGGCAGACGAACCAGAGGTCGTCATCGTACCTCCTCGCCACGGTAGATGCGCCGCGTCGTCGCCGCGACCACCGCCCGTTCGACA
CCTCCCTGAACTCCGCTGCAGGCTCGCACGAGTGATTCAGGAAGCGCATCAGCCCTCCCATCCCTTCAGCATTAATCGCAGCGCAGATCGGGTACGTCGG
CTTCTCGGGCCGCTGCTTCGTCAGGAGACGGTAGCCGTTGTTGCGTGGGCGGTTGGCTCGAGATACGCTGACGTGCTCGATCTCGCCTAGGTAGTGGCCG
AGCACCTCACCGGCGCTGATGTCCTCGGCAGCGACAACCTCGAGCTGCTGGGTGCGGAAGTTGCGGCCAAGGAAGATCTTGCTTGACTCCTCCAAGCCGT
TGCCGCACTTGCCCCCGTACGGGCAGCAACGGGCATTGCAGTACACGTTGACAAGCGCGTTGCGGCAGCTGTCGGTCCGGCAGAGATTCCAGCAACCGCA
AAAGCCGAATGGCTGGACCGCTGGGAAGACGGTGGCCAACGGGTTCTATTGCTCGCGCAAGTGAGCAATGGCGTACGGCCACCGTGCCGGCGCGAACACG
TCCCCCGGCCGTGACGCCTGCAGTTGAGCACGGGGCGCAGCCGCCGGTACTGTCCGTGTCGCTCGTCGAATGTCGTCCGTGCGCTTGGTCTCCGAGCGCT
GGCTGCGTGGCTCATGGCTGGGAACCGTGCGCTGGGTCTCCGAGCGCTGGCTGCGCGGCACATGACGGGGCTCTGTGCGCTGGCTGCGCGGCACATGGCG
GGGCCCCAAGCCTGGCGTGAGTACGGGGCGACAGCGGCTTGGCGGCAGCGATCTTGGAGGCGTTTCCAGGAGCACGGGCGAGGACGTCGTCGGGCTTGTG
CGCGCCCCCGAAGTTGGCAGCGGGGCCGTCGGCGTCTCTGGCGTTGCCGGCGGGTTCGTCACGCGCTTGAATCGGTGCTTGGTCCGCTCTGGAGTGAGCC
AGGGCGGCGTCGCCGTGCCCGTCGCACTGGAGCCGCCGTCAGCACCCATGGCACGGGCGCTGCGGACGTTCGGCGGCGTGTTCTCGTCGCTGGAGGAGGA
GGAGGAGTTGACGATGCATCGGAGCTTCCAGTGGATCGCGGAGTGCGTCAGATGCACCATCGTTCCTGCTGTAACACACGGTGTTAGCCAACAGCCAGTA
GCACTTACTGCAATTGCAGCTCACGTACCGGAGACCGTTTGCTGTCTTCGCGCCTTCGGAGGCTATTTCAAAAGTGAGCGCAACTTCAAGTTGGCGGCAG
GAAGATATAAGCGAGGCAGTATGTCGCCCGAATGACGGTAGAGTGATGGTCGACTTAAAGTATACAAATAACAAGTTAAATATTTAAGATGGCTACACGA
CATATTCATAGGGGTAGGGCTGTCTATCGACACGAAATCTGGGCCTCGCGGGATCTATGACCGGCATATACTCCGCATATCTGCTGCAGATATGTCGACG
GTTTGATATACTTTTGGCAGGCGTCCACTGCCATTTTTAACATATGGCTACATTACACATGATTTTATTTTTAAGCTCTATTCCGTTTAAAACAAGGCTT
TTCCAGCACACTCGAAGCATGAATCAAGGGAAATGACAAGAAAGGGAAGAAAAGCAAGACGTACCTACGCATGCCGGTAGACAACGCGCAGAAGATGAAG
GTTCTCGGTAGTCGGCTCAAAGTCTCTATTGGATGTTATGGTACTGGGTGCTCAATGACGTTAGATAGTTGGGGACGCTCCCATCACACGTGCGTAGCTT
CTTGGAGCAGCCGCTGATGGAGAGCACCGCTTGGTACTCGACCTTGAGGCCGTGGCCTGGCGTCTCCTTCTTCATCTCCTTGTTCATGCTGGCCCACGTG
TTCTCGCTGCTGTGGGTACGGCCGGGCACGCCGCTGCTCTCAAAGAAGTGCGCGATGCTCACAGTAGCGGCAGCACCGCGAACATGTCGGTGGCGGACGT
GACGACAGCGACGGTAGCGAGACGAATAATTAGCAGTGCAAGCTAATTTGAAATACACGCTTTGTTGTGATTTGCAATAAGTGCTTGTGCAGTGACGCCT
AGGACTAAGATGCTACGGTAGTCAGAAACGCGGCGGCATCTCGAGTAGCACACATTCGCACAATTGGAGGAACAGCAACATCGAATAGACCTCGAAATTG
ACTCCGACTTGTGCTTGATGGTTCACCCAATTGTTCAGGGTATTGGCTCCCATACAGTTCTGAATGCTGAAGGCCTGCCTGCAACTCCAGTGAATCGCAG
CCCTCCCATCAACCCCCTTCATAGTAGTGGTAGACTCGCCAACCCTCAATGCCTCCAATTTCTGCGCTGCAGCTTGAAAACCGGGCGAACATTGCAATGG
ATTATCCGGAAACCAAAGGAAAGTCCCCTACGTGACTTCAGTCTGAGCTGCAGCGACGTCTTGAGGAGACAGAGACCCAGCCAACAGGACATTCCAGATT
GGAGGGTAAATGATGTGGTCATCCAGCCATGCTACCGCCAAAGAAAACACCACCTCTTTGAATGCATTAATGTTCACAATCGCAAGCAGTGTGAACAGCT
CCATGGCCTCGCGAAGCCGTTGTAGTCTCGCGGCATCTCGCTGGTCGCCGGGAAGCCTGAGGTGGATCGTTGGCCACTTGGAGTAGTAGTTTGGCTCGGT
AAACGTAACTTGCAGAGTCGGTTCAGCTGAATTGACATTTTCTTGCCGTATAATGCTCTCGTGCAATACGACCCGCCAAGGCTCGAGGAATCCCCATCCG
GCCGCCATGACACCGGCGTAGACCGAGTGGTAACTTGAACAAATTTGCAATGGATCGACTGTGCGTGGTCTAGATATGTCACTCGATCCATCAATCAGTA
TAACATTATTCGCGCAGCCGGTATTACTAACACAACAACAAATCTAGGGTACCCAAATTGATGTGTCTGGATAGATAGATAGAAGTACACAGTTCACGAC
CACCAATCATTTCTGTTGGGAAACTCACACTTGGGTTTTAGCGGAGGAGAACACAGCGAGAAAATGATGTCTACCTGGGAATTCCTGCAGCCTTGGCATG
CCGTTTTACGTGAAAGCGCGGTTCAGCCAAATTGCATCGCAGCAGACGCATCGGTGCGCATCGAACTTTGCTGCGGAGTCCGAGTCAATGTCCATACAGC
GGCTCACTCCATTTTAATCGTGGTCCTCGTAGAGGAGGATAGTCGACGACTACGAGAAGCAATCGAGCTGTTCACGCTGCTCTCGTTCGTGGACAACGAA
GCATTTGTCAAGCTAACGACTTCACCCGGGTATCAACTAAATGGCGACTTCTACGTGGCAAAGTGGCGCCTCTTTTTCCTCGGAGCTCTGTCAGCATCTG
ACGCCACCGCGACCGAAACTTCACTCACCTGGGGCGATCTGCTGGGATGTTATAAGGACCCGTGGGAACACTCGCCTGAATTTCGAGATGCAGCGCACAA
AATAGTGGCGATGGGGCTTGAAAAGGCGGTGGGAGCTTTTGAGCCCATTAACTTCTCAATTTGGTGGAGCTGTAGTTCTCGGGCTGGTAAGCTTAGTGGT
ACACAAGGATACGAGCAGTCGGTTGGCGAGTTGAACGCAGTTTCCGCTAAACTTCGGTGTGTTTTCGAGGCCAAAGCTCCAATTCGAAGCAGGGAGGCTA
GATTTCAGCTTTTTGGGCGGCAAGTCCCAGCGATTGCTACTCAATAAGCTAAAGGGAATCTGGATGGGAACCTGGAAATTACGAATTTCAAATCGTCGCC
CCATATCCTGGCGATGACTGCAGGATTGGCGTGGACGTCGATGCCAACTTTTTTTATAATGTTGAAGTGCCACGATGGGATATCCGCTGATAACGGTGAC
GTGGCGGATCCTCATGTAGTGCAAAATGCCGGATTTTTCTTGGGTACGTTGATCTACGGTCGTTCACTATGCCTGCCGGCAGCGCGTGATGGCAACTTTA
CTATAGTTCCTTCCCGAGCGGCGTATGGAGAGATCAAGTTGGTCTGCCATTCAGTGAGCGACGATGTCTTTTCTCCGCTTGTTCGGCTGTTGCCGAGATG
GATTCGAGGCCAACGTTGACTAGCTTGTGTATGAAGTGGATGACCTCCAAGCGGTGGCCGTGGTTGATCTATTGCCTTCAGTGCAGAGCCTCTGGCATTG
GAGCCACCGACACCGCCGTCTCAACCCTGACGATTCGAGAGAACCAACTGACAAAGGCGGACATGTCCGCTATTGCAGCCGTGCTCGAGACCAGATACCC
CTTACCAGCAGGCGGAGAGGGCATTGCGTACGGGTTTGCGAATGTTGAGGAAGGAGCACAACTGTGGCCGCATGGATTGCCTGAACACGCTAACAACGCC
CTAGTTACTTCGAGTAAATTTCGGTGCAGAGCATCGTACGACGCAGCCACTAACGGGGGGTTTGTCGATCTGGTTGTTCCTGGTTACGGGATCTGCAAGA
CGAGGCTTGGCGAGTCCACGCGATTCATACCCGATCGGACTTCACCTCCACCTCCAGTGAAGAAAAATCGATTCTGTGAGGGCTTGGACCTGTAGTTCGG
CTCGATTAACGATGTGGAATTGCTGATGGGTCTACTGGGTCTGTGCTTTCGTGATATTCGACGTCTATCAATTGCTGGGGGCAAAACGGAAGGCAGCCAA
CCTGTCGTAGATCTCAGCGTGCTGGCCGCCGTTTGTCCGCTGCTGGAATCACTTGACACCACGTATTGCACTGTGGTTGCCTCGACTCATAACGAGGCAT
TACGCACGTGGCCAATTCAAGAGATAACAGTCATGTGCACCTGCGTCATGTCGGACCTGGCAGCGTGCTTGCGGAACCCGGCGCTTTGTGACGCGGACGT
CCGTCTGCCAATGAGATGGCAGAGGACTCCCACGTCAAGTGCTGCTGCACAGCACTTCAGTTTACGCTGGACAGCGTAATACGGGGATGCATGGTTTATA
TTCATTATATGCTATCCTATTGGCTGGTGTCAAAAGTAAACTTGATTATGGGACGCGTAAACATGGACATTCGCGCGACCTCAATGGCTGTAAATCCTTG
ATATGTGCAACAATCAAGTTTTCCAGCCGGACGTTTGATTATGGGACGCAAGTCACAAATTTTGGCCAAGCTACGAATAGGATTAGTAGTTTTTCATTGG
TAGATAAGGATTGATCTAGGATTTGAGATTGATAGACTTTAGGATGGGACCTGGATACTTGTTTGTGTGTCCTGGTCGCCAAGAACTACTGGTTGCGCGG
CGGCGGCGCACCGACGCTAAACTAACGGATCAATCAATCACTTTTCAACTTTCCAACTTCCTCTTAAGTGTTCTTCGAGCGCTCGCCACTGCGCTCATCA
AGCTTCGGGTCTTCGCATCGGCTTGTGTGACATGGTAGCACTTGTTGGTCAAGCTTCGGTTCAAGTTCAAGACTAGGTTGCTCGTGGGGATACCTTCCGA
AGCGAGTTTACCTGTGACTATTGGAGCTAGCCACATATTGGGACGCTCTAGGTTGCGAACGTGCAGTTTTCGGTGGGAGCACACTTCGAAGAAGTGGGTA
CATCACGCCGTGGGCAGGTGGAAATACCACATTGGGGCTTGGCCCACGCCTAGACCGGATAGTACCTAACCTTTGGGGTTGTGTTGGACTCTTACTAGAA
GTCGGTTCAAGCGCGTGACGTTAAAGTATCATCAACGTCTACGCCGGCTCCTCCTCTTGTTACGGCTATTGACACCGATCTCTTCTTCTCGGCGGTCGAG
GCGGAGAAAATTGCGAATTTGCAATCGGATCTTCTCAAGCAGGTCAAAACGGCTAAGAGGGTCCTAGTTAAGTTCCGCAAAGAGGTCTGGGGTATCGAGG
ACGGCAGCGTTGAGGGTAAGGTCGATCGGCAACTCAACTTAGCTCTTCTCGACCTTAAGAGCTGCGAGGACAACATTGCTGCGAAGATTAACGGGCTTAT
CCGCCTAAAACCTCAGAAACACTTAGCTTTAAACACACTTTTAGCTTCACTTCGTCTCCGTTTTATTGTACCGTTTTACGGATCACTCACCGAAAAGTCC
ATCTGCTCGAGACATAATGCCTGTGACAAGGAGTAGGGCGGGTGAGAGTGAATCGCCTAACCCGCAGCAGCGTCAAGTGCCGCGGACGGCTCAAACGGAG
GCGGCAACGCCACAAGAAGCGCAAAGTGAAGCCCCATCGGCGGGGACGACAATCCCTGCGCCTGAGTCAATGTCGATGCAGCAGTTGATGTTGTGGATTG
CACAGCAGCAGCAAATGTATCAGAATCAGATGCAGACCCAGTTACAGATGCAAATGCAACAGGCCAACAGTCGTTTTGAGCAACTACTGGCCTCGCAAGG
TGAACGACGAAAGAAGAATCCTCCCACGTATGAAGGGAAATTTGGCGAAGACCTGGAACTTTGGATTTTTGCTACAGAGGAGTACTACGCTAACAAACGA
GGATTAATGGAGGCCGATACGTCCGATGTTGTGACCATGATGTCAAGCAGTTTAGGCAAGTCTGTGCTGAACTGGTATCGTGCCTTTTCGTCGGATTGTG
ATGCGGCGGGGATGCCGAAATCATGGCAACTGTTTAAGGGAAAGTTGCGCGAGCGCTTTCGCCCGAAAGACTTTGAATACAACCTGCGTGAGCGGTTGTT
TCAACTGAAACAACACGGAACTATCCATGAATACGTGTCGTCGTTTCAGGATTTGATGTCTCAATCCGAGTTGGACATTTCGGAAATGGAGAAACGTTTC
TACTTCCAGAATGGGCTTCGTGCGGAGACGGCTAAGAAGGTGAAGGAACTCAGTCCAAGGTTCTTACATGAGGTCATAGAGATTGCAACGAACTTTGAGT
TTGCTCACTATGGAGGGCTATCGTTAAAACCTGCAGTGAGTCATTAGCCTTCGTCGAAAGCAGTTTCGTCTGTGAAAACTGCGGCTAACAGTACGGCCAA
GCCACAGGAACGAAAGCCACCTTCGAAGCGTGGGCCGAAAGAGGATTGGCTAAAGTCAGCCACTTGTAACAACTGTGGACAATTCGGCCATATCAAGCCA
CAATGTACGTCCACCAAGGAGATGAACCACTATGTTGGCGGATAATTCTATGCTATTTTGGAAGTAAGCGCTTTAGCCTTCAAGCAGGATGAGACCCCCG
CAGAAGTTTCGATCTTCGTCGACAATGGCAGCAGCCTCAACGGTGTCACGGAAGCGTTAGCCGAGCGACTACAATTGGAAATCACGGAGCATCCCGACGA
CATGATGACAGTTCGTCTGGGATACAACCAAACCGTGCAAAGACCAAGACGTACCGTCGAAATGATGCTACAGATTCCGAATTTCCCCGTGACGTGCGAG
ACTTTTACAGTCATGCCTGTTCCAGAAGACAAGGACGTGCTCGTCGGAATGAAGTGGCTTCGGGAGAATAACCCTGACATCGACTGGGAACGCTTACTAT
TGCGTCCACGTAATGGGGCCGAGGAACCCCTGGCCCATCAGTTGGTGGTACCTAACCGACCTCCCGCACGTATGATTGGTTGGCGTCGTTTCAAGAATGC
AAACCAGAACCGTGGAATATTCCATTGCTACCGGCAGGATGGCCACACCGGTGCGTTCGGAGAAACGAAGCTGATCTCAACGAAGCAATTTATGAAAGAA
CTTCGCAAAGGGAAGGGTATTGAAGCTGTTTTTGTTGTGAACCCGCACGACTCAGAAAAGGCTGAGCGTTTTAAGCAACAAGGATGGGAGGCGCTAGTGG
ACAATCCGGCATATGAAGTTTTGCTCAAGTACCGCGATACTGTGTTTCGCACTGAGCTGCCGAGTACCACACTTCCTGTCCGCAAGGGATTGAGCACGAA
ATTCAGCTTCAGCCGGGAACGCAACCGATTTCGGTGGAACAGTGGCGCCAAAGCCCAGAGCAGCGCAAGGTCATCCAAGATTGGATGAAGGAGATGGTAC
AGGCTGGAATCATTCGCCCTAGCACCTCGGCATTCAGTGCCCCAACTTTTTGTGTCAAGAAACCCGTGGGTTGGCGTATTGTGCACGACTATCGCCAGCT
CAACAGCTCTACCATTTTGCCGGCCATACCCATGCCGAGGAAGGAAGACACATTCGACGCAATGGGGGGTAGTTACTGGTTCTCCTGCATGGACCTCTTG
TGGGGATATTACCAGGTTAAACTTCGTGAATCTGACATTCCATTTACTGCTTTTTCGACGCCCGATGGGCTGTTTGAGTATCTTGTCACCCCTATGGGTT
TGAGCGGTAGTCCTGGCACTTTTAACCGGTTGTTTCAGCGGGTGTTTAGAGACCTACGCGATGTCATGCGCATCTACTTTGATGACATCTATGTTTTCAC
TCAAGACACAGATGTTCGGACGCATGTCGAAGCGTTGGACAGAGTACTCCAACGCTGTCAAGAGCAGCAGCTGTATGTCAAGTTGTCAAAGTGCCAGTTT
TGTGTCGAAGAGATCCCTTGTCTTGGTGATTTTGTGGGCCACAATGGTGTTCGAATGGACCCTGACAAAGTGCGTGTGATTCGCGAGTGGCCGATTCCAC
AGACAAAGAAGCAAATGGAAAGCTTCTTGGGTACTACGGTCTATGTCTCGCGCTTTTGCGCCGACTTCGCGCAATTCGCAGGACCATTGCATGAAAGTAC
TAAGGGTTTGCGCCCAAAGGAAACGCTGCATTTGTTTGAGCACCAGTTGAAATGTTTTCATGAACTCAAGCGCCGTCTCTCCACCCCTCCCGTGTTGCAA
CTTCCTGATTTCGAAAAATCGTTCGGTATTCGTATGGATGCCTCGAACTTTGCCGTAGGGGGCGTCTTGTTTCAAAACGAGGGAGGGCTCGAGCATCCGA
TCGCATTCACTGGTCGTAAAATGAAACCAGCGGAGCTAAACTACCCAGTGCGCGAACAGGAATTGCTGGCTATTATGCATGCGCTTCGGGTGTGGAGAGT
CTACCTGCTCGATCGGCCATTTACGGGGAGACAGACCACAAGAGTATTGAGACTATATTGACGCAGAAGACAACAAACCGTGGTGTGGCTCGCTGGTTCA
ATGAACTAGCCGAGTTCCAACCACAGTTCAAATGGAGTCCAGGCGACAGTAACCAAGTGTCGGATGCAGTGTCTCGAAACCCACTCTTTGAGCACAATGC
CGCTCAGGTTAGTCTCAGTGAGCTCATTGAAGCGGCTCGAAACCGTGAAATTGTAGCTAGCGTCCAAACGACCAGTGCAACTGTGACGCACTCGGCCAAA
CAACTGTACTCTACAGACCGAAGAGTTCAGGAGCTGTTGCAGAGTATCGCTAGTGGTAAAGAGGTACCACGCTACTCTGTGAAGAATGGACTGCTGTATT
ACCAAACGAGAGATGATGAAAATGCTCGACTGGTAATTCCGGGCAATGAAGATCTGAAGAACCGTGTTATTTGTGAAAACCACGATGTGGTCACGGCAGG
TCACCCCGGATACTTCAAGACATATGTGGTGAAGCACCGAACAAGAATTTCCAACTGCGATGACATCAAGCGACACGGTGGCAGAACGATAGGCAGGGAT
CAGGCTGCGGGTCGCGGATCAAGAGGGTCTATTGAGAGATCTCAAGCGATTGGATAACGTCGACGCGTAAGGCAACACATATGTCAAGACAGATTACGGG
CGATCGCGCTTTGACTGCGGCATGATTCGATGTAGACCCAAGCCCGGATCGACGACCAATCTCGCAGATCTAGGGCGGCCGAGAACAGAAGAGGACGGAT
CGGCAGCGCACGGCAACTCGCACAGGTCATCGATCGGGAGTTGATCGCCGATCGCCGATCGGGATCGATCGTGGATCAGGAGGCGATCGTGGATCGCCGA
TCGGGATCGATCGTGGATCGGGAGCCGATCGTGGATCGCCGATCGACCCGGATGGGCACATGGGGGCGAAGCCAGGGCAAGAATCCAGTAATCGTTTGGT
TGTAGGATGGTAGATGAGATGGCAGCGGTAGAGAGAGACCAGCTAAACATAAATCAGAACGCAATTTGCACAGAAGACCACAAGTGCCCTCAAGTCGTCA
AGTCCCAGGAGCTACATTGGCCTCGGCAAGCGTTGACTGAACTAGCGGTACGGTTAAGACTGGATTAATACATTGGCCAGCTTGACCTACTGTAGTGATC
TTTCTCTCGTGTGCAAGTCCTCGATCGACCGGATACTGCTTGGCCGGCGATCGCTGCGTCTCTCAATCGACCTCGATCCCGCTATAGGAAGCGGCAAGCA
ACTCAGGAAAGGAAGGAACACACCCGGAAAGGCAACTAGAGGCCTTGGATCTACTCCAGGCCGACCGATCGAAGCGAAGAACCCTCGATCGGAGCGTATA
CTCGGACGCAGAGCGAAGACTACCGCGCTGCTCCGCAAACTATCCCCGCGTCACGCCAAGACACTCGATCTTCACCAGGTGCTGCATCTTCGGAGCCCCG
AGAGAGCAGATCCAGCCCGCCGACGGGTACACAAGGTGAGAACAAGTTCAGCCGATCACGGATCGTTGGGGGACCCCCTCCGTTAGTCGGTGTCCGGGCG
CTGGTGGGAAGCTCGATCAGGCCTTAACCAGATTTTGGCCGATGCCGCTACCCCACAATGGTGCGCGTGCCCGAATCTCTTGGGGACTCCGGATTTCACC
GTGAGTCCGTAGAAGATGCGCAAGTGAAGAAAGAACCAGGGGAAGAGGCGTCGTCGGATATCGGATCGACGAAGACGCTGCTGAACAAAACGAGATCCGC
GGATCGACAGAGGACTTCTGTCGACGGAATCGAGGGCGATCTGGAGACAGATCTAGAAGACAAACCTCAACATCCTCCCCAGGTCCCTTCGGGGACCCCG
GTGGATCTTGGTGCGAACCGAGATTCACTAACAAAACAAACTAAGGCGGGATCGGACCGATACGCGTTCGCTGACTCGCCGATCAGGCTCGATCCGGGCT
ATCTGGACGCGATCGCGGACAAGACCCAGATCGTGAGGAAGAAGCTGAGAGCGCCAGGCTTGGACGACGAAGATCCCAGACCGTCGGCGCTCGACTGGTC
TGAGGCTGACCTGGATCGTCAGTATTACTTGAAGGAACTGCGAGATTTCTTGCGTCAAGATCCTGTCATGGTGATCGTGCGGCCAGAGCAGATCGACGAC
CCGAAGGGCCCGATTTCGGCCCCCCGAGTGACGGATAACAAGCTGATGGCGGTGAAGAACCTGCTCGGGCTGTTGAAGGAAGCCGGCTTCGTGGCTGGCG
CCTTTGAAGCGAACGATCTTTTCGATCAAGATCTCGATGTGATCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGACCTTTGGTCGAGATGATCGC
GGACAGTCCGGACGCGAATGTACCAGATCCAGTGTCGCCGGCTCCAGTGTCATCGCCTCGAGTGGAGTCCACTGGGTACCGATCGTCGTCACCTTATGTC
TCCGCAGCGGAACATGTATCGGATACGTCGTCTGAACCCCAACGGATGTCCCTCGGCCCTTCAGGATCTGCGATGTTGGACGCGCGATCACGGAGTCAAC
GTCAGGAACGCATGCGGTCAGGACCTCGGAAGCAGAAACCCAAGTCGACCGATCGGACCACCAGTGCCACCGGATCAGATGAGTCGAATGGCAGATTGGA
GTCTTACTTTCAGGCTGCGATGACTCGATTTCTGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGGCCTTCTTGGAAGGGAGGTCATGTGACGTGGACGTCCGTCTGCCAATGAGATGGCAGAGGACTCCCA
CGTCAAGTGCTGCTGCACAGCACTTCAGTTTACGCTGGACAGCGTAATACGGGGATGCATGGTTTATATTCATTATATGCTATCCTATTGGCTGGTGTCA
AAAGTAAACTTGATTATGGGACGCGTAAACATGGACATTCGCGCGACCTCAATGGCTGTAAATCCTTGATATGTGCAACAATCAAGTTTTCCAGCCGGAC
GTTTGATTATGGGACGCAAGTCACAAATTTTGGCCAAGCTACGAATTGGATTAGTAGTTTTTCATTGGTAGATAAGGATTGATCTAGGATTTGAGATTGA
TAGACTTTAGGATGGGACCTGGATACTTGTTTGCGTGTCCTGGTCGCCAAGAACTACTGGTTGCGCGGCAGCGGCGCGCCGACGCTAAACTAACGGATCA
ATCAATCACTTTTCAACTTTTCAACTTTCTCTCAAGTGTTCTTCGAGCGCTCGCCACTGCGCTCATCAAGCTTCGGGTCTTTGGCCAATCAGAACTCGCA
AAACCAGGCGACTTTTTACAGCTCTTCCCGGTGTTATATTTGATTTTTGTATGTATGAACATTTTATGCACTTTTTTTGCAGCATCTCTCCGCTGCAGAT
CAGGTGTAGCTCATAACTAAGGTTATTCGGTAGGTACATACGAAAGTGTCTATCAGTACAGCATGGGCCAGAGAAAGGACCAACGGAGGCGAGCGGTTGC
GAGGTCGCGTAGCCATAGCAGACCCGCACGGGGTGCCCGCGAAGCAGGGCCGCGCGATATCTGCGGAGGCGGGCCCAGCGCCGAGCATTTCAGCGAGCCG
AGCACTGTACTCGCCAGGTGAGAGAATCTTTTTATCGCAGGAGCGCAGCGAAGCAAAGCCCATAATCCTATACAAAATCAAGATATCGGTTTTCGCTGTG
CTGTACTAATATCCTATGTCGGTACATACAGCTGTTTACACTTTTTCATGCACACTTCTTGTGTATTCGGATTGGCTGATGTGACTGTCAGCTGGTCATA
ACAGAGTCAATCCGGTGAAAAACATGTCGATTGTTAAAATGGACCAGCGAAGATTGAATCTCGGTTTGAGTCTTGATGTCAGTTTGCACACATGCAGTGC
TAAGTGCATTGCCGTTTGCCCGGCAGAGTTTTTGGTTATAATACATACAGAGTAGAATGGTGATTACTGTACACTGTGATCTCATGAGTGATGATCTGAC
CTTAAACTATGTGCAGCTGATTCTTTCTAACTGCCTAGATCCTGACATCAATGTCATCTTGTGGGGGGGGGGTAGTGTATTAATAAATGGTCACACAATT
CATTCATCGGAATGTCCATTCATTCCTGAAATTGAACTAAAATAACACGTCGCTGACACTTTTTGACTACGGTAACCTAAGAAAAGTTGCCCTAGAGGTA
ATAGTAATACAGTATTACAGTATTACTAATACTGTAGAATACACGTAGCGAAATACGAAACTGCTTTGCTCGAAACATGCGGAAACCCGGAGCGCTTATT
AGATGTACATAAACGACGGCTGCCCTCTCGGTACTGGACGCCTACCAAAAGTGTTCTAATCACCCGCCATATCTGCAGCAGATATGGCGGTTCTTATTTC
CGAGTACGTCTGCTTATCCTAAATTTGCTCCACCACAAAAGACATATAAGGGCATCTCCGGTCGTTATATTTAGTCCCCTTCGGCCACTGATACGATTAA
ATGGCATTTGTATCCGGGCACTTAGTCTAGGACACTAAAACATGCGCAATCCTTCCAGATTTCGCCCCCGCTCGAAGTTCGCCATTTTTGAGAGCTACTC
AAGAGCAGACGAGATGAGCGAGGAAGAGGACACGATGCTGCTGCTGTGCGAGGCGTACCTGCAGCACAACGCGAAGCTGCACGAGGCCCGCCGCGACGTG
CACGACGCGTTGGCAGAGGAGGCGTGGCGCATTGCGGTGCGCACGTGCCACTACCTGACCTCGCAGTGCCTCGACACGCCCTGCGAGGCCGCGTGGATGA
CCTTGTACACCAGCGGCCACGACCGCAACTTCCTAAACGTAACGAGCCTAACAAGGTAAGGTA