Description :
From Genome Similarity Track
Location :
contig_22:28023- 29463
Transcript NameFunction/comments
g5558.t1hypothetical protein

Sequence
1440 bases(100 bases per row)
AGCTCATGGCGAGTGCTTCTGTCTGTGGATACTTGCACGTGTCTTGGCCTCGCCGTCGGTGCTTGTGACGTGGCGGCGGCCGATTGCTGCAGTTGAGAGT
CAGTAGCCGGAACGACGGCACTCACTCGGGGTATACATGTGTACCACATGAGTTAGACAGTGTAGCCCTGGGTTTTCGTTAGCTGCATCCATGCTGGGGA
CTTGAGCGCGTAGACAACTTGCAGCAATTTCATTTCAAGCATTTTGACTGTTGTTGAAGGTGCCCTACTCTATCGTCTCTGCTTGCGACTTTCGAACTTG
CGGAATCGGGATACGGCACGATCGTCGCTGGCCTGATTCTTGCCCACTACAAACAGCAACAGGATGTTAGACGTCAAACTGATCAAACTGGGATTACCGC
AGTGAACTAGCACACCTTTGTGGAATCCCCGCTCGCGTTGCTCGTCTACAATGTACACAGCATTCCAACACCCATCAGCCACCAACCCACCTCACCAAAC
AACTCCACGCTCATCCTCTTACCTTTGTTCAGACTCTTCATCTCCGCAACATAGTCCGTTCGGTGTCGATTGAAGTCGACACTGAAGTTTGCCGGCAGCA
CAGAGCTCGCAAGTCCTCCCACGGCATCCAGCTTTGCAGCGCTGGATTTACTCGCCTCTAACGCTCTCCTTGTTGCCTTCTCCGTCCTCTCTGCATACAG
CGCCGGCAGCTCCACTTCTGCAATGCCTGCACTCCCCATGAGCATCCCTCCTTCCGTCCCTTCATCGTAACTCTGGTTACCCATCGGTACATCAGGTTTC
AAGTGCTCCGGCAGCTCGAACAGCTTGTCCTCCGCACTCTTCATAGCCGCAGCTGCGTCCTCACTGACTGCGTTCTGCTGCGTCTCCGTCTTCCGCTTCT
TCTGCAGCCTCTCCTCTATGAACTGGTTCATGAGCTCCTCGTGCTGGTCCTTGTCGGTCGTGGCGCTTTGGCCCGTGAACTGTCCGTCCAGCAGCGTCAG
CAGCTTCTGATTGGCCGATCCCTCCTTCTTGGGGTCGTGCAGTCCGTACTGAGCGCTCTCCGCTGGTGCTTCCATCTTTTTGTGCTGCTTCTTGGCCGCC
TCAGCCTTGTGACTGGCCAGCTCCCCCCGCAGCACCTGCTCCCGCAGTCGCTGGTCCTCGCGCAGCTCCTTGATCGAGCGCTGGATCTGCTCCACGTCTA
CATCCTCGCATTGCGCATCTTCAGAGGCGCCATTTGCATCGTCTAGAGGGCGTCGAGAGCGCTTGCAGCCTGCTCCGCGTTTGCTCTTCTTCTTGAAGCT
CACCTCCATCCGTCACTGGCAAAACGGAGGAAATTGGAAGACGATGATTGGATGAAAAAAAATGGAGGAAAGTTTATGGGTAGTTTTGGTGACGAATCGA
GGAAAATGACTTGTCCACGCCGGCGCTTCCTGAAAGGAGG