Description :
From Genome Similarity Track
Location :
contig_129:28021- 29260
Sequence
1239 bases(100 bases per row)
AGCCCCAGGCCACCAGCTTGCTTGGGTAAATATACGATCGCCGGATTGAGCTTGTGACGTGCTGATTCCGCTGACGTTGCATGGTGCCACAGGAATTGCT
TCTGTAGGTTCTGGAGTTGCTTTTCCGCCCAGTCCGGAGGTTCGAAGGCTGCTGCTGTGAATAGCACGGCTGGAAGCATGATTACATTTAGGATCAGGAC
CCTGAGTTCGACGCTGGTGGCCAGATTTGTTGCCGTGGCCAATCGCCTCTGCACATTCCTGATTCGAATCGCCCAATTTGGATCCGTTAGCTCGCCCGTC
CCGACCGCGAACCCTAGATACCGAACTGTTTCTCCATGCTGAAGCACCGGGATCTCCTGGTACTTTTTCAGCTTCACTGTTGTGTTCAAGAAGATGAGCT
TGCTCTTGGTTGGCTGAATCCGGAGGCCTGAGAGTCGGCCAAAGACGTCGACTATTTCCATGACCCTCGTTAGCATACTGGCCTTTTCCAGGAAAACTGT
TGAGTCATCTACAAACGCCGAGAACGTGTGCTCGGCTGCCGGTGTTCCTGGAACTCGGAGGCCTTTGATTTGCTTGTCCTGTTGGATTGCTAACGCTAAT
ATTTCTGCCGCTAGTAGAAACAGAAGTGGTGCGAGTGGACACCCTTGCCTGATTCCGGATACGATGTCGAGTGGCTCGGATAGGCTGCCGTTAATCAAAA
ATCGTGCTGTCGTTCCTTGATGTAACTTCCTGATCATTACTCCGAACGCGTTCGAGAATCCGAACTTTTCCAGTACTAGGAAGAGGAATGCTCTGGCCAC
TGTATCGTAGGCCTTCTTAAAATCGAGCATCAGGATCACTCTGCTCTCCAGTGCTGCTAGGTCGGGTTCTTGTTTTGCGGTTGTTAGCATTGCGAGCATC
ATCATGACCGTTTTCATCATTTGTCTGCCATGCACGAAGCCTTGCTGTGACTCTCCAATTGTACGTCCCATCACCTTTTGAACCCGGGATGCTATGATCT
TCGTGTAAACCTTATACCCGGTTTGGAGGAGAGAAATTGGTCTGTAATCCATCGCGTTGTCCGAGTCTCCTTTCTTCCTCAAGGGAATGATGAGCCCTTC
GAGGAAGGATTTTGGTGGTTCTCCTCCTTTTAGGAGCTCATTGCCGATAGCCACCATAGCTGGCACGAGAAGCGCCTGGGCGTCTTTGAACAGATCGTTG
TTGAGGCCATCCGGGCCCGCTGCTTTATGCCTGTTCAAC