Description :
From Genome Similarity Track
Location :
contig_3:28020- 29870
Transcript NameFunction/comments
g723.t1hypothetical protein F442_00687

Sequence
1850 bases(100 bases per row)
CGTCGCCATTTTTCCAGTCACCACAGCAGGAGTCGGGGGAACGACCATAGGCCCATCCTCCGACTCACTCTCGGCAGCATCGTCCTCGTTCTTGTCTTCT
TCACTCTCAGAGGCATCAGCTGCCTCCTCTAGGCCACCCCTCGTGCGTCTCTTCCTGGCGTAAACAACCGCGACTGCCGCCAGAACAACAGCGGCGAAAG
CCACCACCGCCGCAACCACCGCCAACTGCTCACCACTGAGCCCTCCAAAGCTCGTGGCATCAGCAGCAGCGAACGTCACCGTGGCCGAGTTCCCAGCTGC
ACTGTCATCGTCTCCCACCTCCGTCTCGCCGTAGCCTGCATGTGCGACGTCCGTCTCTCCACTTGACGATCCACTGCAGTCCGTAGTCGCCGGCGTCGGG
GTCTCTGTCTCTGTCTCTGTCTCTGTCTCTGTAGCTGCAGGTGTTGGGGTTAGAGTCGGCATCTCTGTGTCAGTGGCTGCGGGCGTTGGGGTCGGAGTCG
GTGCCTCTGTGTCATTGCTCTCTGTAGCTGCAGGGGTCGCCTCTGGCGTCGCAGTCGTCGGAGCGGGCGTGGGTTTGTCCCCACAGTCGTAGATCTCACG
CAGCTGCGTGGTCTGCGTGAACCAGCTCTCGTCGTAGTCCTCATTGCCATCGAAGGAGCCGGAGCTATCCACCGAGTCGTCTCCGCTGTAGTCCCACGTC
TCACACGCGCTCTCCTGCTCCTGCGGTGCCTCGTTGCAGCCCACAGACGGCAGCACGCAGCCCCACGTGTCCCCATTCACCACCTGGCACTGCGCGTCCT
CAGGTGCCACGCAGCTGCCGCTCCCGAACGACGCGAGCGTCGAGAGGCAGTCAGCCACTGCTACGTCGCCCGCCTTGGGACAGCTCCAACCCGCGGGGGA
CGATCCAGAGCCCGCGCACAGCGACGAAGCGTCCACTGACAGCTCGTACGTGGCATCGCGGCATACGCTCACTTGCACGGCGGCGGCGGACGACATTCCC
AGCGCCACGAACAGCGAGAAGCGAAGCGGCGTCATGTTCTCGTCCGTCGATTCTCCAGAATGGCGATCCAGGTGCAGAATGGCGACCTGATATTTTCGAC
TTTGACGGGGTTTCGTTGGTGATTGGCCGGAAAAGGCAAGATATGGGTTCAACTTGCATGTCAAGGTTTGGCTCGCCTGCATAATTGATCGGAATGCTGC
GACCAGCGAGTGGTTTACACGGGGTTCGTTGCATCTTGATGAGTTGGCTGGTCGATGACAAGCTCTGCATTCCGCACCGTTGGGAGCTCTTCGGGGTCGT
ATGGTTTTGCTCCGGCTCCGTTGTTGCTGACTGTGCTAGCGTCTCGTTGCGGTCGGTCATTATCATTGCTAAAACCAGCTAGGTCAACCACCTCTTGCCC
GTTAGAGAGACTTGCAGGGTCTGTTGGCCGCCGTTTTTCGTCTATAAGCCGCGTCATTATCTGCGCCATATACTCGCACGCAAGCTGCTGGTCTCCTCGA
ATCGAAGGTGAACACTTCGAAGGAGCAACGGACAGTTCACCAGCAATCGGCTCTTCAATCGCCGTCGCACGAATGTTTTCTCCTAGATTTGCCTCCGCGT
CGTCAGCTTGCTTCACTGCCGCATGCATGGCTTCAAGAGCCATCTCTAACTCTTCTGCCGTCTGTTCCTGCAAAAATGCCAAATCCTGCTGCCAGTTAGG
AAACACACATTTCACCACGTCTGGAACCTCCTCAACGCCTGGAGTCCAGACCGATCGTTGATCAGCAGTCGCATCCGGAGCCACGGGTGGAAGCAGAGCC
TCTGCTTCAGATTCCTCTCCACGTACAACATCAGCGTCTTCGTTACCCAC